ID: 1022616351

View in Genome Browser
Species Human (GRCh38)
Location 7:31934746-31934768
Sequence AAATTTTACTCAAGGTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022616347_1022616351 -10 Left 1022616347 7:31934733-31934755 CCTAAATGCCCAGAAATTTTACT 0: 1
1: 0
2: 4
3: 38
4: 408
Right 1022616351 7:31934746-31934768 AAATTTTACTCAAGGTCAGTTGG No data
1022616345_1022616351 9 Left 1022616345 7:31934714-31934736 CCTCTTATGCCATCATTCTCCTA 0: 1
1: 0
2: 1
3: 19
4: 240
Right 1022616351 7:31934746-31934768 AAATTTTACTCAAGGTCAGTTGG No data
1022616346_1022616351 0 Left 1022616346 7:31934723-31934745 CCATCATTCTCCTAAATGCCCAG 0: 1
1: 0
2: 0
3: 22
4: 210
Right 1022616351 7:31934746-31934768 AAATTTTACTCAAGGTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022616351 Original CRISPR AAATTTTACTCAAGGTCAGT TGG Intronic
No off target data available for this crispr