ID: 1022617966

View in Genome Browser
Species Human (GRCh38)
Location 7:31951876-31951898
Sequence ATCTCCTTGTGGAAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 372}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022617966 Original CRISPR ATCTCCTTGTGGAAGAGGGA AGG (reversed) Intronic
901689648 1:10964388-10964410 GTGGGCTTGTGGAAGAGGGATGG + Intronic
902830347 1:19008387-19008409 ATCACCCTGTGGAGGAGGGTGGG - Intergenic
904411951 1:30330042-30330064 ATCTCATTGTGGAAGAAGTGGGG - Intergenic
905081498 1:35325271-35325293 AGCTCCTTGGGGAATAGGGAGGG + Intronic
905554938 1:38874716-38874738 ATCTCCTTGTGAAGGAGGAAGGG + Exonic
905883966 1:41481880-41481902 TTCTCCATGTGGGTGAGGGAAGG + Intronic
906328360 1:44863672-44863694 ATACCCTGGTGGAAGAAGGAAGG - Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907413536 1:54298716-54298738 AGCTCCTTGTGGAGGTGGAAGGG - Intronic
907756729 1:57317837-57317859 ATCTCATTGAGGTTGAGGGAGGG - Intronic
908676981 1:66615615-66615637 ATTTTCTTGTGGAAAATGGAGGG + Intronic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
911931658 1:103912317-103912339 ATCTCATGGTGGAAGGCGGAAGG + Intergenic
912015397 1:105027762-105027784 TTCTGCTTGTGGAAAAGGGAGGG + Intergenic
915015689 1:152731067-152731089 ATCCCATGGTGGAAGATGGAAGG - Intergenic
915257174 1:154642742-154642764 ATCTCATGGTGGAAGATGAAAGG + Intergenic
917213510 1:172655092-172655114 ATCTCTTTGAGGAGGAGGGGGGG - Intergenic
917246264 1:173004666-173004688 CTCTGCCTGTGGAACAGGGAAGG - Intergenic
917407871 1:174727911-174727933 ATTTCTTTGTAGAAGAGGAAAGG + Intronic
917670257 1:177266946-177266968 AGGTCCTTGTGGAAGAGGCTGGG + Intronic
917986566 1:180326254-180326276 CTCTGCCTGTGGAAAAGGGAGGG - Intronic
918149615 1:181787037-181787059 TTCTGCTTGTGTAGGAGGGAGGG + Intronic
918358056 1:183724575-183724597 CTCTGCTTGTGGAAGGGGGAGGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919124818 1:193381191-193381213 GTCCCCTTGTGGAAGGTGGAAGG - Intergenic
921840363 1:219821722-219821744 ATCTCCATGTGGTGGAAGGAAGG - Intronic
922171976 1:223163200-223163222 ATCTCCATGGGGAAGAGAAAGGG - Intergenic
922721468 1:227902148-227902170 TGCTCCTAGGGGAAGAGGGATGG + Intergenic
923392507 1:233527867-233527889 ATCTTCTTGTGGTAGAGAAATGG + Intergenic
1062962367 10:1582271-1582293 ACCTGCTGGTGGCAGAGGGAGGG + Intronic
1063149603 10:3324238-3324260 ATATCCCAGTGGGAGAGGGAGGG + Intergenic
1063687524 10:8252319-8252341 TGCTCCCTGTGGAACAGGGAAGG - Intergenic
1063925525 10:10973497-10973519 CTCACCATGTGGAAGAGGCAGGG + Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1068112640 10:52697819-52697841 ATATACTTCAGGAAGAGGGAAGG - Intergenic
1068877017 10:62007910-62007932 CTGGGCTTGTGGAAGAGGGATGG - Intronic
1069801381 10:71084057-71084079 ATCTCCTCGTGTAAAAGAGAAGG + Intergenic
1070949182 10:80417394-80417416 AACTCCTTGCGGAAGGGGGTTGG + Intronic
1071907687 10:90192190-90192212 CAATCCTTGGGGAAGAGGGATGG - Intergenic
1071963044 10:90824781-90824803 CTCTTCTTGTGGAAGGGGGAGGG + Intronic
1072969042 10:100000799-100000821 TTCTCCTTGAGGAATTGGGAAGG + Intronic
1074533959 10:114315502-114315524 CTCTCCTTGGGGAAGGGGCAGGG - Intronic
1077023539 11:430171-430193 ATCTCCTTGCTGAAGGGGCAGGG + Exonic
1077922551 11:6652585-6652607 AGGTCCCTGTGGAAGAGGAAGGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078559482 11:12357982-12358004 TTCTCTTTGGGGCAGAGGGAAGG + Intronic
1078576878 11:12510038-12510060 ATGTCTTTGTGGCAGAGAGAGGG - Intronic
1079642786 11:22828272-22828294 ATCTCAGTGTGTAGGAGGGAAGG + Intronic
1080454349 11:32404676-32404698 ATGTCCTTGTGGACAAGGTAGGG - Intronic
1080692070 11:34566572-34566594 ATCTGCAGGTGGAAGAAGGAAGG - Intergenic
1081028365 11:38045005-38045027 CTCTCCATATGGAGGAGGGAAGG - Intergenic
1081233666 11:40618779-40618801 TTTTCCCTGTGGAAGTGGGATGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083422429 11:62561906-62561928 AACTCCTTGTGGAAGGGGGTTGG - Intronic
1083528768 11:63397616-63397638 CTCTGCTTGTGGAAAAGGGTGGG - Intronic
1084180865 11:67445192-67445214 ATCTCTTTCTGGGAAAGGGAGGG - Intergenic
1084188772 11:67489426-67489448 ATCTCCATGTGGAAGATGAGGGG - Exonic
1085063489 11:73470628-73470650 ATCCCATGGTGGAAGAGAGAGGG - Intronic
1086400675 11:86458908-86458930 ATGACCTTGTTGGAGAGGGAAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087775501 11:102253133-102253155 ATCTCATGGTGGAAGGTGGAAGG + Intergenic
1087889492 11:103520540-103520562 CTCTCATTGTAGAAGAGGCAAGG - Intergenic
1088715183 11:112542806-112542828 ATCTCCTTGTGGAGGGGTTAGGG + Intergenic
1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG + Intergenic
1090262584 11:125332095-125332117 AGCTCCTTGAGGAGGAGGGCTGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090549964 11:127808836-127808858 CCCTGCTAGTGGAAGAGGGAAGG - Intergenic
1092609798 12:10160183-10160205 ATCTTTTTGTGAAAGAGGTAAGG + Intronic
1092918750 12:13211918-13211940 TTCTCTTAGTGAAAGAGGGAAGG + Intronic
1094858165 12:34428476-34428498 AACTCCTTGAGGAAGAGGATGGG + Intergenic
1095155688 12:38851032-38851054 ATCACATGGTGGAAGACGGAAGG - Intronic
1095216418 12:39555594-39555616 ATCTACTTGGGGAAAAGAGAGGG + Intronic
1095567994 12:43648898-43648920 AACTCCATGTTGAATAGGGATGG + Intergenic
1095635128 12:44423782-44423804 ATTTCCATGAGTAAGAGGGATGG + Intergenic
1096411021 12:51377224-51377246 ATCTCCTTGAGCAAGATGGCAGG + Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098961464 12:76743979-76744001 ATTTGCTTATGGAATAGGGATGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101443739 12:104722591-104722613 TTCTGCTTGTGGAAGAGGACGGG + Intronic
1101540483 12:105660502-105660524 ATCTCATGGTGGAAGATAGAAGG + Intergenic
1102848108 12:116209697-116209719 ATCTCACTGTGGTAGAGGGTTGG - Intronic
1102906780 12:116682554-116682576 ATCTCCTTGTGGGACACAGAGGG - Intergenic
1103143699 12:118575219-118575241 ATATCCTCCTGGAAGAGGAAGGG - Intergenic
1103250189 12:119493199-119493221 ATCTCCTTTTGGAAAATGCACGG - Intronic
1103444345 12:120984464-120984486 TTCTCTTTGTGGGAGAGAGAAGG + Intronic
1103917846 12:124385186-124385208 CTGTGCTTGTGGAGGAGGGAAGG + Intronic
1104104775 12:125649090-125649112 ATCTCCGTGAGTAAGAGAGATGG - Intronic
1107524151 13:41213774-41213796 CTCTGCTTGTGGAAAGGGGAGGG - Intergenic
1107714545 13:43187181-43187203 ATCTTATCTTGGAAGAGGGAGGG + Intergenic
1110251349 13:73384257-73384279 ATATCCTTGGGTAACAGGGATGG + Intergenic
1110774600 13:79393718-79393740 ATCACCTTGTGGGGGTGGGAAGG + Intronic
1112600975 13:100855530-100855552 ATCTGCATGTGGAACAGGGCGGG + Intergenic
1113564695 13:111312910-111312932 CGCTCCTTGTGGTGGAGGGATGG + Intergenic
1113633194 13:111901808-111901830 CTCTCCCTGTGGAAGGGGGCAGG + Intergenic
1115274311 14:31590358-31590380 ATCTCCTTGAGGAACAGGAAGGG + Intronic
1115395951 14:32908452-32908474 ATCTACATGTGGAGAAGGGAAGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116656671 14:47662428-47662450 AGCTCTCTCTGGAAGAGGGAAGG + Intronic
1117835815 14:59804945-59804967 ACCTGCTTGGGGAAGAGGGTAGG - Intronic
1117939440 14:60946127-60946149 ATCTCAATCTGAAAGAGGGAGGG - Intronic
1121087874 14:91160324-91160346 AACTCCTTATGGCAGAGGGAAGG - Exonic
1122632261 14:103112380-103112402 AGCGGCTTGTGGCAGAGGGAGGG + Intergenic
1123107720 14:105850474-105850496 ATCCCCTTGTGGATGAGGATGGG - Intergenic
1123208024 14:106732456-106732478 AACTCCTTGGTGAAGAGGAAGGG + Intergenic
1123481448 15:20636054-20636076 AACTCCTTTTTGAAGAGGAAGGG + Intergenic
1123636564 15:22364311-22364333 AACTCCTTTTTGAAGAGGAAGGG - Intergenic
1125348516 15:38743352-38743374 TCCTCCTTGTGAGAGAGGGAGGG - Intergenic
1126231094 15:46326024-46326046 ATCTTATTTTGGAAGAGGGTTGG - Intergenic
1127332727 15:57954767-57954789 ATCTCCTTGGAAGAGAGGGAGGG + Exonic
1128477362 15:68008681-68008703 ATTGCCATGTGGAAGAGGTAGGG - Intergenic
1129801218 15:78416050-78416072 ATCTCCTGGAGGAAGTGAGAAGG + Intergenic
1132730402 16:1358183-1358205 AGCGCCTGGGGGAAGAGGGAAGG - Intronic
1132907219 16:2288898-2288920 GTCTCCTTGTGGCAGGGGGAGGG - Intronic
1133768643 16:8855016-8855038 ATCTCCTGGAGGAAGGGGTATGG - Exonic
1133883389 16:9804123-9804145 AGCTTCTTGTTGAAGATGGAGGG + Intronic
1134210558 16:12272870-12272892 TTCTCATCGTGGAAGAGGAAGGG + Intronic
1135780663 16:25297422-25297444 CTCTCCTTGCTGAAGGGGGAAGG + Intergenic
1137010380 16:35314957-35314979 AACTCCTTGCGGAAGGGGGTTGG - Intergenic
1137027485 16:35492441-35492463 GGCGCCTTGTGGCAGAGGGAAGG - Intergenic
1137336438 16:47554131-47554153 ATCTCCCTGGGACAGAGGGAAGG - Intronic
1138262548 16:55635620-55635642 ATCTCCTTGGCCAAGAGGCAGGG + Intergenic
1139018792 16:62723204-62723226 ATTTCATAGTGGAAGATGGAAGG + Intergenic
1139483778 16:67245182-67245204 ATATCCCTGTGGGGGAGGGAAGG + Intronic
1140641955 16:76985243-76985265 ATCTCTGTGTGGAAAGGGGAAGG - Intergenic
1141270910 16:82540413-82540435 TTTTCCTTGGGGAACAGGGATGG + Intergenic
1141866445 16:86753123-86753145 ATCACCTTGTGGAGGAGGGATGG + Intergenic
1143274436 17:5699773-5699795 ACCTCCTGGGGGAAAAGGGAAGG + Intergenic
1143509763 17:7388954-7388976 ATCTACCTGTGGAAGCAGGAGGG - Exonic
1143541106 17:7569655-7569677 ATCTTCTTGCAGTAGAGGGAAGG + Intronic
1146977113 17:37122985-37123007 ATCTCCTTGGTGAAGATGGTAGG + Intronic
1147957773 17:44146580-44146602 ATCTGCTTTAGGAAGGGGGAAGG - Intronic
1152302430 17:79503088-79503110 ATCCTCATGTGGAAGAGAGAGGG + Intronic
1152407318 17:80105055-80105077 ATGTCCTTGGGGAAGAAGGTGGG - Intergenic
1152771824 17:82174523-82174545 AACTCCTTGCGGAAGGGGGTTGG - Intronic
1153356542 18:4143350-4143372 TTCTGCTTGTGGAAAAGGGAGGG - Intronic
1154428664 18:14291676-14291698 AAGTCCTTGAGGAAGAGGGGTGG + Intergenic
1155328219 18:24687658-24687680 ATCTACTTGAGGGAGAGGGTGGG - Intergenic
1157907923 18:51586057-51586079 ATGTACATGTGGATGAGGGAGGG - Intergenic
1158165116 18:54531563-54531585 AACTCCTTGAGGAAAAGGGGTGG + Intergenic
1158387341 18:57010108-57010130 AACTCCATGTGGAAGCAGGAGGG + Intronic
1158948952 18:62474449-62474471 ATCTGCCTGTGGAAAGGGGAGGG - Intergenic
1159013311 18:63080231-63080253 ACTGCCTTCTGGAAGAGGGAGGG - Intergenic
1159082834 18:63754670-63754692 AACTCCATCTGGCAGAGGGAAGG - Intronic
1159152210 18:64535069-64535091 ATCTCTCTGTGGAAGATGGAGGG + Intergenic
1159477674 18:68944130-68944152 AACTCCTTGAGGAAGGGGGTTGG + Intronic
1161059677 19:2208639-2208661 CTCTGCTTCTGGAAGAGGGAGGG - Intronic
1161656950 19:5522239-5522261 AGCTCCTGGTGGCAGGGGGAAGG + Intergenic
1161836720 19:6652652-6652674 ACCTCTTTGTGCAAAAGGGAAGG + Intergenic
1166042998 19:40214325-40214347 TGCTTCTTGTGGAGGAGGGAGGG + Intronic
1166256118 19:41606152-41606174 ACCTCCTGCTGGAGGAGGGACGG - Intronic
1166926267 19:46270729-46270751 AACTCCTTGAGGAAGGGGGTCGG + Intergenic
925150885 2:1613914-1613936 ACCTCCTGCTGGGAGAGGGAGGG + Intergenic
925292591 2:2757517-2757539 ATTTCCATGTTGATGAGGGAAGG - Intergenic
925658724 2:6179946-6179968 ATTTACTTGGGGAAAAGGGAGGG + Intergenic
926477229 2:13339086-13339108 ATCTATTTGTGGAAGACAGAAGG + Intergenic
927297632 2:21472855-21472877 GTCTCCTCATGGAGGAGGGATGG + Intergenic
927488235 2:23503909-23503931 GGCTCCTAGTGGAGGAGGGAAGG - Intronic
928951976 2:36821329-36821351 ACCTGTTTGTGTAAGAGGGATGG - Intergenic
929164843 2:38871625-38871647 ATCTCATGGTGGAAGATGGAAGG + Intronic
929225488 2:39507838-39507860 ATCTCCCTCTGGAACAGAGAGGG + Intergenic
929281677 2:40087160-40087182 CTCTGCTTGTGGAAAGGGGAAGG - Intergenic
929329477 2:40663242-40663264 ATCTACATGTGGAAGTTGGAAGG + Intergenic
929474058 2:42227495-42227517 TTTTCTTTGTGGAAGAGGGGTGG - Intronic
929983311 2:46699933-46699955 ATCCTCTTGGGGATGAGGGAGGG + Intronic
931218581 2:60268408-60268430 ATCTCCTTGTGAAAAAGGGAAGG + Intergenic
931288151 2:60849798-60849820 ATGTCCTTGTGGAAGGCAGAGGG + Intergenic
931623382 2:64233137-64233159 AGGTCCTTGTGAAAAAGGGATGG + Intergenic
933893611 2:86791392-86791414 ATCTCCTGGGGGAAGGGAGAGGG - Intronic
934544898 2:95206766-95206788 AACTCCTTGCGGAAGGGGGTTGG + Intergenic
935006353 2:99082060-99082082 AACTCCTTGAGGAAGGGGGTCGG - Intronic
935259104 2:101339383-101339405 AACTCCTTGAGGAAGGGGGTTGG + Intergenic
935319131 2:101868550-101868572 ATCTCAGTGTGGAAGAGTAAAGG + Intronic
936477532 2:112852348-112852370 AACTCCTTGAGGAAGGGGGTGGG + Intergenic
936884911 2:117299249-117299271 GTGTCCTTGTGGCAGAGGGTGGG - Intergenic
936940340 2:117878216-117878238 CTCTTCTTGTGGAAAGGGGAGGG - Intergenic
937508293 2:122561992-122562014 ATCCTCTTGTGTAAGAGAGATGG + Intergenic
937718589 2:125063903-125063925 CTCTCCCAGTGGAAGATGGAAGG + Intergenic
938649596 2:133368779-133368801 AAATCCTTTTGGAAGTGGGAGGG + Intronic
939897560 2:147810406-147810428 ATCTTCTTGTGAATGTGGGAAGG - Intergenic
940963098 2:159807537-159807559 ATATGCTGGTGGAAGAGGAAGGG + Intronic
941742279 2:169047455-169047477 TTCTGTTTGTGGAAAAGGGAAGG + Intergenic
942005677 2:171697378-171697400 ATCTACTTGTTGAAGAGGGTGGG + Intronic
942659549 2:178249888-178249910 CTCTCCTACTGGAAGTGGGAAGG - Intronic
942707246 2:178789560-178789582 ATCCCCATGAGGAAGGGGGAAGG - Intronic
943541560 2:189221478-189221500 AAATCCTTGGGGAAGAGGGGTGG + Intergenic
943562397 2:189479330-189479352 CTCTCCTAAAGGAAGAGGGAGGG - Intergenic
943801660 2:192067324-192067346 TTCTCCTGGAGGAAGAGGGATGG + Intronic
944752159 2:202721106-202721128 CTCTCCTCATGGAAGAGGGGAGG - Intronic
945203827 2:207310783-207310805 GTCTCCTTTTGGGAGAAGGAAGG + Intergenic
946572430 2:221039712-221039734 ATCTCCATGTAGAGGAGGCAGGG + Intergenic
947544534 2:231001476-231001498 ATCTCCATGTGTAGGAGAGATGG - Intronic
1169695006 20:8377400-8377422 TTCTTCTGATGGAAGAGGGAAGG + Intronic
1169988738 20:11474981-11475003 TTCTCCTTGAGGAAGAGAGAGGG + Intergenic
1170373302 20:15673130-15673152 AGCTCCATGTGGTAGAGAGATGG - Intronic
1171238249 20:23545287-23545309 CTCTCCTTGAGGCAGAGGAAGGG - Intergenic
1172152194 20:32798378-32798400 ATTTCCCTGTGGAAGTGGTAAGG + Intronic
1172649856 20:36495283-36495305 ATCTCATAGTGGCAGATGGATGG + Intronic
1172701676 20:36857040-36857062 CTCTCTTTGTAGAAGAGGCAGGG + Intronic
1172831184 20:37836385-37836407 ATGTCCATGTGGGAGAGGGGAGG - Intronic
1172994318 20:39058817-39058839 ACCTTCTGGTGGAAAAGGGAGGG - Intergenic
1173204161 20:40979674-40979696 CTCTGCTTATGGAAGTGGGAGGG - Intergenic
1173632045 20:44523872-44523894 AAATCCTTGAGGAAGTGGGATGG - Intergenic
1176691873 21:9921987-9922009 CTCACATGGTGGAAGAGGGAGGG - Intergenic
1177805125 21:25867842-25867864 ATCCCCTTTTGGAAGGAGGAGGG + Intergenic
1180525285 22:16253159-16253181 ATCTCCTTGTGGAAAAAGAGGGG - Intergenic
1180934018 22:19612101-19612123 ATCTCATTTCTGAAGAGGGATGG - Intergenic
1181129273 22:20720717-20720739 ATTTCCTTGTAGAAGACGGCTGG - Intronic
1181397762 22:22633849-22633871 GCCTCCTTGAGGAATAGGGATGG - Intergenic
1181651649 22:24262209-24262231 GCCTCCTTGAGGAATAGGGATGG + Intergenic
1181705729 22:24648530-24648552 GTCTCCTTGAGGAGTAGGGATGG - Intergenic
1181760747 22:25057247-25057269 ATCCCCAGGTGGAAGAAGGATGG + Intronic
1182437242 22:30338602-30338624 ATCTGTTTGTGGAGGAGGGTTGG - Intronic
1183037315 22:35150088-35150110 ATCCCCTTGGGGAAGGGGGCAGG - Intergenic
1183266797 22:36832453-36832475 ATGTTTTTGTGGAAGAGGGCTGG - Intergenic
1183497262 22:38154004-38154026 CTCTGCTTGTGGAAAGGGGAGGG + Intronic
1183781580 22:40002359-40002381 CCCTCTTTGGGGAAGAGGGAGGG + Intronic
1183952074 22:41357672-41357694 CTCTCCTGGTTGAGGAGGGAGGG + Exonic
1184116528 22:42425900-42425922 AACACCTTGGGGGAGAGGGAGGG + Intronic
1184122612 22:42462325-42462347 ATCTCCCTGTGCCAGAGGGTAGG - Intergenic
1203323082 22_KI270737v1_random:87759-87781 ATCTCCTTGTGGAAAAACGGGGG + Intergenic
950184231 3:10935164-10935186 ATCACAGTGTGGAAGACGGAGGG + Exonic
950584866 3:13885081-13885103 ATGTCCTGATGGAGGAGGGAGGG - Intergenic
950695581 3:14699008-14699030 CTCTGCCTGTGGAAGAGGGAGGG - Intronic
950801024 3:15551981-15552003 CTCTTCTTGTGGAAATGGGAGGG - Intergenic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
954276117 3:49542736-49542758 AATTCCTTCTGGAAGTGGGATGG - Intergenic
954452404 3:50578877-50578899 ATGTCCTGGTGGAAGACGTAGGG - Exonic
954980408 3:54740575-54740597 AGCTCTTTGTGGAAGGGGGAAGG - Intronic
955141995 3:56278726-56278748 CACTCCTGGTGGAAGAGGAAGGG + Intronic
956040584 3:65140992-65141014 ATCTCATGGTGGAAGATGGAAGG - Intergenic
956391164 3:68774020-68774042 ATCTCCTGGATGAAGAAGGAAGG - Intronic
957270035 3:78018131-78018153 TTCTCTTTGTGGAAGAGGTAGGG + Intergenic
958816013 3:98916298-98916320 AACTTCTTGTGGAAGATGGTAGG + Intergenic
958936969 3:100266060-100266082 GTCTACTTGTGGAACTGGGAAGG + Intronic
959648956 3:108733240-108733262 ATTTCCTGGTGTCAGAGGGAGGG + Intergenic
960067378 3:113387954-113387976 CTCTGCTTGTGGAAAAGGGAGGG + Intronic
961528696 3:127526261-127526283 ATCTCCTTGGGGCAGCAGGAAGG + Intergenic
961691893 3:128675952-128675974 AACTCCTTGCGGAAGGGGGTTGG - Intronic
961906548 3:130268876-130268898 ATCTGCTAGAGGAAGAGGCATGG - Intergenic
962038724 3:131682872-131682894 CTCTGCTTGTGGAAAGGGGAGGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963766807 3:149345344-149345366 ATCTACTTATGGAGGAGGGTGGG - Intergenic
964349870 3:155791737-155791759 TTCTGCTTGTGGAAAGGGGAGGG + Intronic
964391896 3:156206426-156206448 TTCTCCTTGTTGCAGGGGGATGG - Intronic
965236830 3:166135924-166135946 ATCTGCCTGTGGAAAGGGGAAGG - Intergenic
965824108 3:172713419-172713441 AACTGCTGGTGGAAGAGGGAAGG - Intergenic
966062196 3:175771666-175771688 GTCTCCTTGTAAAAGAGAGATGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967180276 3:186897226-186897248 AACTCCTTGAGGAAGGGGGTTGG - Intergenic
967434827 3:189431644-189431666 TACTCCTAGGGGAAGAGGGAGGG + Intergenic
967476388 3:189925500-189925522 TTCTCTTTGTGGGAGAAGGAGGG - Intergenic
969283074 4:6184491-6184513 ATTTTCTTGAGGAAGAGGGAAGG - Intronic
970069287 4:12138347-12138369 CTCACATTGTGGAAGAGGCAAGG + Intergenic
970168525 4:13265010-13265032 TTCTTCTTGTGGTAGAGGAAAGG - Intergenic
973327385 4:48877550-48877572 CTCTCCCTGTGGAAATGGGAGGG - Intergenic
973794802 4:54413939-54413961 CTCACATGGTGGAAGAGGGAAGG + Intergenic
973794999 4:54416160-54416182 CTCACATGGTGGAAGAGGGAAGG + Intergenic
974301075 4:60067668-60067690 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
975201630 4:71597091-71597113 ATCTCATGGTGGAAGGTGGAAGG - Intergenic
976171661 4:82310952-82310974 CTCTCCTTATGGAAGGGAGAGGG - Intergenic
977263099 4:94822130-94822152 ATCTCATGGTGGAAGGTGGATGG + Intronic
977336212 4:95702545-95702567 ATCTCCATGGGGAAGAGTAAGGG + Intergenic
977732461 4:100370328-100370350 ATGTCCTGGGGGAAGGGGGAAGG + Intergenic
978177995 4:105757745-105757767 ATCTCCTTGTGAAATAGGTTGGG - Intronic
978520460 4:109610009-109610031 CTCTGCTTGTGGAAAGGGGAGGG - Intronic
979213228 4:118132300-118132322 TTCTCCCTGTGGAAAGGGGAAGG - Intronic
979325864 4:119378823-119378845 ATCTCCCTGTGGCAGAGGGAGGG + Intergenic
980364459 4:131782190-131782212 CTCACATGGTGGAAGAGGGAGGG - Intergenic
980693068 4:136320706-136320728 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
980996287 4:139782874-139782896 ATCTCCATCTGAAAGATGGAGGG - Intronic
981271894 4:142855168-142855190 ATGACCTTGTGGAGCAGGGAAGG - Intergenic
983147555 4:164235949-164235971 CTCTCCTTGTGTAAAAGGCAAGG - Intronic
983243780 4:165263971-165263993 ATTTCCCTGTGGCAGAGGGAGGG + Intronic
983338018 4:166420979-166421001 CTCTGCTTGTGGAAAGGGGAGGG - Intergenic
983560509 4:169097025-169097047 GTTTCCTTGGAGAAGAGGGAGGG - Intronic
984611446 4:181844043-181844065 ATCCCCTGGTGGAAGGCGGAAGG + Intergenic
988456632 5:31392740-31392762 CTCACCTGGTGGAAGAGGCAAGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989698174 5:44229361-44229383 ATGTGTTTGTGGAAGAGGGCAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991764664 5:69961967-69961989 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991782660 5:70156186-70156208 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
991843896 5:70837038-70837060 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991875103 5:71156500-71156522 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
992169341 5:74086599-74086621 ATTGCCTTATGGAAGATGGAGGG + Intergenic
992556343 5:77907099-77907121 AGCTTCCTGTGGAAGTGGGATGG + Intergenic
992776060 5:80090315-80090337 ATCCCCTGGTGGAAGATGGAGGG - Intergenic
994217800 5:97158847-97158869 CTTTGCTTGTGGAAAAGGGAGGG - Intronic
994994912 5:107048471-107048493 TTCTCTTGGTGGAAGAGGGATGG + Intergenic
995227199 5:109714196-109714218 ATATCCTTTTGCAAGAGGGAAGG + Intronic
995961264 5:117842662-117842684 AACTACTTGTGGGAGAGGGTGGG + Intergenic
997337889 5:133120682-133120704 ATCTCCTTGGTGAAGAGGGAGGG - Intergenic
999092422 5:148948377-148948399 ATCTCCTTTTGTAACAGAGAAGG - Intronic
999919459 5:156303212-156303234 CTCTGCTTATGGAAAAGGGAGGG - Intronic
999929777 5:156418625-156418647 ATCTCCTTGTGGAAGATGTAAGG - Intronic
999986042 5:157006425-157006447 AGCTGTTTGTGGAAGAAGGAGGG + Intergenic
1000292597 5:159884471-159884493 ATCTCATGGTGGAAGTGGAAAGG - Intergenic
1000310270 5:160036738-160036760 CTCTCCTTTTGGAAGCAGGATGG - Exonic
1001936066 5:175706872-175706894 CTCTCTATGTGGAAGGGGGAGGG + Intergenic
1002027900 5:176407894-176407916 ATTTTCTTATGTAAGAGGGATGG - Intronic
1004273269 6:14213212-14213234 CTCTCATGGTGGAAGAGGCAAGG - Intergenic
1005162842 6:22884348-22884370 ATTTACTTATGGAAGAGTGAAGG - Intergenic
1005508551 6:26491738-26491760 AACTCCTTGAGGAAGGGGGTGGG + Intergenic
1005727241 6:28661768-28661790 ATTTCCTTATGGAAGTGGTAGGG + Intergenic
1006562615 6:34926705-34926727 TTCTCCTCCTGGAAGAGTGAGGG - Intronic
1007314854 6:40979136-40979158 ATATCCTTGTGGAGAAGGAAAGG + Intergenic
1008057812 6:46963343-46963365 AGCTCCTTGCAGAAGAGGAAAGG - Intergenic
1009192161 6:60642113-60642135 AGCTGCCTGTGGAAGAGAGATGG + Intergenic
1010596469 6:77769599-77769621 ATCTGCTTGAGGAAGGTGGAGGG + Intronic
1011052503 6:83168685-83168707 ACCTCAGTATGGAAGAGGGATGG + Intronic
1011779774 6:90774608-90774630 ATCTCATGGTGGAAGGTGGAAGG + Intergenic
1012519467 6:100103593-100103615 CTCACATTGTGGAAGAGGCAAGG + Intergenic
1012717740 6:102698679-102698701 TTCTGCTTGTGGAAAGGGGAGGG - Intergenic
1012848108 6:104415000-104415022 ATCTGCTTTTGAAGGAGGGAAGG - Intergenic
1012892169 6:104908625-104908647 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
1013908606 6:115246990-115247012 CTCTACTTGTGGAAAGGGGAGGG + Intergenic
1015480181 6:133700159-133700181 ATCTCCTTTGGGAATAGGGATGG + Intergenic
1016606802 6:145938292-145938314 ATCTCATGGTGGAAGGTGGAAGG - Intronic
1017699024 6:157049629-157049651 ATCTCATTGAGGAAGAGGGGAGG + Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019782146 7:2947541-2947563 ACCTCTTTGCGGGAGAGGGAGGG - Intronic
1021034852 7:15785206-15785228 TTCTGCCTGTGGAAAAGGGAGGG + Intergenic
1021214542 7:17900548-17900570 CTCTACTTGTGGAAAGGGGAGGG - Intronic
1022617966 7:31951876-31951898 ATCTCCTTGTGGAAGAGGGAAGG - Intronic
1022666552 7:32416376-32416398 GTCTCCTGGAGGAACAGGGAGGG - Intergenic
1025709106 7:63891216-63891238 ATCTCCTGGAGCCAGAGGGAAGG + Intergenic
1026033021 7:66811447-66811469 ATCAATTTTTGGAAGAGGGACGG - Exonic
1026734303 7:72939794-72939816 ATCCATTTCTGGAAGAGGGAAGG + Intronic
1026784635 7:73294702-73294724 ATCCATTTCTGGAAGAGGGAAGG + Intergenic
1027109435 7:75425226-75425248 ATCCATTTCTGGAAGAGGGAAGG - Intronic
1027437526 7:78180290-78180312 AGCTCCTTGTGCAATATGGATGG - Intronic
1027604944 7:80288382-80288404 CTCTGCTTGTGGAAAGGGGAAGG + Intergenic
1028217807 7:88156581-88156603 ATCTACTTTAGGAAGAGGGAGGG + Intronic
1028266520 7:88733247-88733269 CTCTGCTTGTGGAAATGGGAGGG - Intergenic
1028957463 7:96709812-96709834 GTTTCCTTGAGGAAGAGTGAGGG - Exonic
1029444521 7:100604784-100604806 ATCTCCTAGGGGAAGAGGCGCGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030431543 7:109455283-109455305 TTCTGCTTGTGGAAATGGGAGGG - Intergenic
1030499658 7:110343619-110343641 ATCTCCTTGTGGTTGTAGGATGG + Intergenic
1031054989 7:116983524-116983546 ATCCCCTAGGGGAAGGGGGATGG - Intronic
1031260132 7:119507517-119507539 TTCTGCTTGAGGAAAAGGGAAGG + Intergenic
1031268633 7:119615563-119615585 GTCTCCTTGAGGAAGGAGGATGG - Intergenic
1031503023 7:122545140-122545162 ATCTTCATGAGGCAGAGGGAGGG + Intronic
1032660132 7:133973912-133973934 ACCCCCTGGTGGAAGGGGGAAGG + Intronic
1034299665 7:150004354-150004376 ATCACCTTGTGCAAGAGCTATGG - Intergenic
1035318107 7:158010082-158010104 CTGTCCTTGTGGAGGAGGCAGGG + Intronic
1035517883 8:252016-252038 ATCTCCTGGTTGAATAGGGGAGG + Intergenic
1035550860 8:523706-523728 CTCTGCTTGTGGAAAGGGGAGGG + Intronic
1035647831 8:1242234-1242256 ATGTGTTTGTGGAAGAGGGGAGG + Intergenic
1036646613 8:10614774-10614796 ATCTCCTGGGGGGAGGGGGAAGG + Intronic
1036786940 8:11694042-11694064 ACCTCCTTGGGGAAAAGGGCAGG - Intronic
1037771171 8:21800988-21801010 TTCTCCTTAGGGAAGTGGGATGG - Intronic
1038278256 8:26139782-26139804 CTCCCCATGGGGAAGAGGGAGGG - Intergenic
1038285721 8:26204709-26204731 ATTTCTTTTGGGAAGAGGGAGGG - Intergenic
1038809744 8:30828107-30828129 GTCTCATTGTGGAAGAAGGGAGG - Intergenic
1039194926 8:35020376-35020398 ATCTCATGGTGGAAGACAGAAGG + Intergenic
1041024014 8:53665906-53665928 ATCTTCTTGGGGAAGTGGGAGGG - Intergenic
1042978358 8:74497014-74497036 AGCTCTTTTTGGAAGAGGGCAGG + Intergenic
1043570804 8:81600378-81600400 AACTCCTTGAGGAAGGGGGTTGG - Intergenic
1045571777 8:103375064-103375086 TTCTCCTTGGGGAAGAGGGGTGG + Intronic
1046972930 8:120242887-120242909 GTCTCCTTCTGGATGAAGGAAGG - Intronic
1048029828 8:130620988-130621010 TTCTGCTTGATGAAGAGGGAGGG - Intergenic
1050618563 9:7429117-7429139 CTCTGCTTGAGGAAGGGGGAGGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051808961 9:21029128-21029150 ACCTTCTTGGGGAAGGGGGAAGG - Intronic
1052522414 9:29564632-29564654 ATCTCCTTAGGAAAGAGGGTGGG - Intergenic
1053386655 9:37696537-37696559 AATTCCTTTTGGAAGAAGGAGGG - Intronic
1053602979 9:39629727-39629749 CTCTCTATGTAGAAGAGGGAGGG - Intergenic
1053628810 9:39908080-39908102 CTCACATGGTGGAAGAGGGAGGG - Intergenic
1053777258 9:41558264-41558286 CTCACATGGTGGAAGAGGGAGGG + Intergenic
1053860628 9:42383475-42383497 CTCTCTATGTAGAAGAGGGAGGG - Intergenic
1054215077 9:62342622-62342644 CTCACATGGTGGAAGAGGGAGGG + Intergenic
1054250559 9:62712709-62712731 CTCTCTATGTAGAAGAGGGAGGG + Intergenic
1054364474 9:64320222-64320244 CTCACATGGTGGAAGAGGGAGGG - Intergenic
1054564667 9:66747221-66747243 CTCTCTATGTAGAAGAGGGAGGG + Intergenic
1054672404 9:67812727-67812749 CTCACATGGTGGAAGAGGGAGGG - Intergenic
1055747859 9:79470554-79470576 ATCTCTCTAAGGAAGAGGGAAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056395606 9:86178674-86178696 ATCCCATGGTGGAAGACGGAAGG + Intergenic
1056472899 9:86923428-86923450 ATCTCATTGTGGAAGGCAGAAGG - Intergenic
1057559772 9:96118088-96118110 GTCTTCTTCTGGATGAGGGAGGG - Intergenic
1059069235 9:111118040-111118062 ATCCCATGGTGGAAGATGGAAGG + Intergenic
1059269825 9:113064975-113064997 AACTCCTTGCGGAAGGGGGTTGG + Intergenic
1059270959 9:113070423-113070445 AACTCCTTGCGGAAGGGGGTTGG + Intergenic
1059272092 9:113075869-113075891 AACTCCTTGCGGAAGGGGGTTGG + Intergenic
1059273227 9:113081311-113081333 AACTCCTTGCGGAAGGGGGTTGG + Intergenic
1059274363 9:113086757-113086779 AACTCCTTGCGGAAGGGGGTTGG + Intergenic
1059338964 9:113586672-113586694 AGCTACTGGTGGAAGAGGGCAGG - Intronic
1060320422 9:122553907-122553929 ATCTCCTGGAGGGAGATGGAAGG + Exonic
1060987349 9:127827374-127827396 ATCTCCTGGTTGGACAGGGATGG + Intronic
1203772701 EBV:57710-57732 AGCTGCCTGTGGCAGAGGGATGG + Intergenic
1185550998 X:982272-982294 AACTCCTTGAGGAAGGGGGTTGG + Intergenic
1186285734 X:8042248-8042270 AGCTCTTTGTAGAAGAGGGCAGG - Intergenic
1187011876 X:15287839-15287861 ATGTGCTTATGGAAGAGGAATGG + Intronic
1189584513 X:42444494-42444516 ATCCCCTTGTGGCAGAGAAATGG + Intergenic
1190614445 X:52216428-52216450 ATGTCCTTGCGGAGTAGGGATGG - Intergenic
1194507680 X:94752718-94752740 CGCTCCTTGGGGAAGGGGGAAGG + Intergenic
1195396200 X:104412733-104412755 TTCTGCTTGTGGGAAAGGGAGGG + Intergenic
1195917282 X:109948149-109948171 CTCTGCTTGTGGAAAGGGGAGGG + Intergenic
1197011637 X:121571018-121571040 TTCTGCATGTGGAAAAGGGAAGG + Intergenic
1197139171 X:123097090-123097112 CTCTGCCTTTGGAAGAGGGAGGG + Intergenic
1198143080 X:133825509-133825531 ATTTTCTTGGGGAGGAGGGAGGG + Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199367332 X:147002518-147002540 AACTCCTTGAGGAAGGGGGTGGG - Intergenic
1200315933 X:155132999-155133021 CTCTGCCTGTGGAAGGGGGAGGG + Intronic
1200744895 Y:6895387-6895409 AACTCCTTGAGGAAGGGGGTGGG - Intergenic
1200948160 Y:8866441-8866463 AACTCCTTGAGGAAGGGGGTTGG + Intergenic
1202074128 Y:21021510-21021532 AACTCCTTGAGGAAGGGGGTGGG + Intergenic
1202078828 Y:21063365-21063387 AACTCCTTGAGGAAGGGGGTGGG + Intergenic
1202378937 Y:24260109-24260131 ATCTCCTTGTTTGGGAGGGACGG - Intergenic
1202491845 Y:25410012-25410034 ATCTCCTTGTTTGGGAGGGACGG + Intergenic