ID: 1022620759

View in Genome Browser
Species Human (GRCh38)
Location 7:31982173-31982195
Sequence TCTCAACTGCACCCCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022620754_1022620759 10 Left 1022620754 7:31982140-31982162 CCTCCAAGGAGTCAACAGCGACC 0: 1
1: 0
2: 1
3: 4
4: 53
Right 1022620759 7:31982173-31982195 TCTCAACTGCACCCCTGAGCTGG No data
1022620755_1022620759 7 Left 1022620755 7:31982143-31982165 CCAAGGAGTCAACAGCGACCCAG 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1022620759 7:31982173-31982195 TCTCAACTGCACCCCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022620759 Original CRISPR TCTCAACTGCACCCCTGAGC TGG Intronic
No off target data available for this crispr