ID: 1022621247

View in Genome Browser
Species Human (GRCh38)
Location 7:31986721-31986743
Sequence TCTTCCCCAGGGTCGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022621240_1022621247 8 Left 1022621240 7:31986690-31986712 CCACCAGATGCTGGGAAGAGGCA 0: 1
1: 11
2: 91
3: 243
4: 589
Right 1022621247 7:31986721-31986743 TCTTCCCCAGGGTCGATGGAAGG No data
1022621241_1022621247 5 Left 1022621241 7:31986693-31986715 CCAGATGCTGGGAAGAGGCAAGG 0: 1
1: 8
2: 91
3: 249
4: 686
Right 1022621247 7:31986721-31986743 TCTTCCCCAGGGTCGATGGAAGG No data
1022621238_1022621247 15 Left 1022621238 7:31986683-31986705 CCAGGAGCCACCAGATGCTGGGA 0: 1
1: 14
2: 130
3: 461
4: 1078
Right 1022621247 7:31986721-31986743 TCTTCCCCAGGGTCGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022621247 Original CRISPR TCTTCCCCAGGGTCGATGGA AGG Intronic
No off target data available for this crispr