ID: 1022624644

View in Genome Browser
Species Human (GRCh38)
Location 7:32022479-32022501
Sequence CCACATTCATGACTTCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022624644_1022624650 -4 Left 1022624644 7:32022479-32022501 CCAAGGAGAAGTCATGAATGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1022624650 7:32022498-32022520 GTGGAAAATCATGGGGTGATGGG No data
1022624644_1022624651 -3 Left 1022624644 7:32022479-32022501 CCAAGGAGAAGTCATGAATGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1022624651 7:32022499-32022521 TGGAAAATCATGGGGTGATGGGG No data
1022624644_1022624656 27 Left 1022624644 7:32022479-32022501 CCAAGGAGAAGTCATGAATGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1022624656 7:32022529-32022551 TGGTTTAAGGGGAGCACAGAAGG No data
1022624644_1022624657 30 Left 1022624644 7:32022479-32022501 CCAAGGAGAAGTCATGAATGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1022624657 7:32022532-32022554 TTTAAGGGGAGCACAGAAGGTGG 0: 1
1: 0
2: 4
3: 21
4: 229
1022624644_1022624655 16 Left 1022624644 7:32022479-32022501 CCAAGGAGAAGTCATGAATGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1022624655 7:32022518-32022540 GGGGAATGAAGTGGTTTAAGGGG No data
1022624644_1022624654 15 Left 1022624644 7:32022479-32022501 CCAAGGAGAAGTCATGAATGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1022624654 7:32022517-32022539 TGGGGAATGAAGTGGTTTAAGGG 0: 1
1: 0
2: 0
3: 16
4: 213
1022624644_1022624649 -5 Left 1022624644 7:32022479-32022501 CCAAGGAGAAGTCATGAATGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1022624649 7:32022497-32022519 TGTGGAAAATCATGGGGTGATGG No data
1022624644_1022624652 7 Left 1022624644 7:32022479-32022501 CCAAGGAGAAGTCATGAATGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1022624652 7:32022509-32022531 TGGGGTGATGGGGAATGAAGTGG 0: 1
1: 0
2: 3
3: 65
4: 750
1022624644_1022624653 14 Left 1022624644 7:32022479-32022501 CCAAGGAGAAGTCATGAATGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1022624653 7:32022516-32022538 ATGGGGAATGAAGTGGTTTAAGG 0: 1
1: 0
2: 0
3: 28
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022624644 Original CRISPR CCACATTCATGACTTCTCCT TGG (reversed) Intronic
900949894 1:5852741-5852763 CTACATTCAGGACTTATCCCAGG + Intergenic
901063164 1:6483027-6483049 CCACATTCACGCCCTCTCATGGG + Intronic
901957453 1:12797044-12797066 CCCCATTCCTATCTTCTCCTTGG - Intergenic
901965463 1:12862802-12862824 CCCCATTCCTATCTTCTCCTTGG - Intronic
901980863 1:13033181-13033203 CCCCATTCCTATCTTCTCCTTGG - Intronic
902001225 1:13195750-13195772 CCCCATTCCTGTCTTCTCCTTGG + Intergenic
902020459 1:13341454-13341476 CCCCATTCCTATCTTCTCCTTGG + Intergenic
906106148 1:43293820-43293842 CCACATTCTTGCTTTCTCATGGG + Intergenic
908062272 1:60364255-60364277 CAACATCCATTACTTCTCTTAGG - Intergenic
910737200 1:90472968-90472990 CCACAGGAATGATTTCTCCTGGG + Intergenic
913136337 1:115893171-115893193 CCACATTCCCCACTGCTCCTGGG + Intergenic
914048380 1:144109645-144109667 GCACATTCTTGTATTCTCCTGGG + Intergenic
914130804 1:144855803-144855825 GCACATTCTTGTATTCTCCTGGG - Intergenic
915843628 1:159239211-159239233 CCCCATTCATGTGTTCACCTTGG + Intergenic
916130463 1:161607283-161607305 CCAGATTCATGACTTCGTCCTGG + Intronic
917392425 1:174553014-174553036 CCACATATATGTCTTCTTCTGGG + Intronic
918978994 1:191530390-191530412 CTACCTTCTTGACCTCTCCTTGG - Intergenic
920764887 1:208822928-208822950 CCAGATTCATTACTTCTCAAGGG - Intergenic
1062961923 10:1578856-1578878 CCACACTCATGCATTCTCCCTGG + Intronic
1063382175 10:5592297-5592319 CCCCATGCATGCCTGCTCCTAGG + Intergenic
1063458227 10:6200216-6200238 GCAGATTGATGATTTCTCCTAGG - Intronic
1063807384 10:9661024-9661046 CCACATATATGACTCCTCCAGGG - Intergenic
1063873355 10:10444441-10444463 TCACATTCATCACTTCTCGGTGG - Intergenic
1067527995 10:47049795-47049817 GCACATTCATGACCTCTGTTTGG - Intergenic
1070055636 10:72932081-72932103 CCACATTCATAACTCCTGCATGG - Intronic
1070112545 10:73499001-73499023 CCAGATTCCTGACTACTCCAGGG - Exonic
1070774645 10:79102584-79102606 CCAATTTCATGACTTTTCCATGG + Intronic
1074158621 10:110819150-110819172 CCAAATCAATGACTACTCCTGGG - Intronic
1078448967 11:11426238-11426260 CCACATTCATGCCATATCCCTGG + Intronic
1079922382 11:26448841-26448863 CCACATTCACTGCTGCTCCTGGG + Intronic
1081592571 11:44435002-44435024 CCAGATCCACGACATCTCCTGGG + Intergenic
1082754268 11:57057519-57057541 CCATATTGATGACTTCTCCCTGG + Intergenic
1083727228 11:64634908-64634930 CCACATTTGTGACTTCCCCTGGG - Intronic
1083969808 11:66068024-66068046 CCACATTTATGACATGTCCACGG + Exonic
1084305888 11:68283090-68283112 CCACCTTCATGCCTGCCCCTGGG + Intergenic
1084956477 11:72694202-72694224 CCACATTACCGCCTTCTCCTTGG + Intronic
1087638188 11:100726939-100726961 CAACTTTCAGGACTTCCCCTAGG - Intronic
1089589736 11:119532720-119532742 CCCCATTCATGAGCTCTCCGGGG - Intergenic
1089637284 11:119823344-119823366 TCACCTTCCAGACTTCTCCTTGG - Intergenic
1090198739 11:124839307-124839329 CCAAATTTATGGCTCCTCCTCGG + Intergenic
1090439593 11:126714606-126714628 CCAATTTCCTCACTTCTCCTTGG + Intronic
1090600113 11:128361524-128361546 TCACAGTCATCACTTCCCCTGGG - Intergenic
1092717528 12:11406134-11406156 CCACATTCAGTCCTTCTTCTAGG + Intronic
1093370744 12:18362120-18362142 CCCAATTTATGGCTTCTCCTTGG - Intronic
1095397716 12:41779437-41779459 CCACCTTCATCTCTTCTTCTTGG + Intergenic
1095513365 12:42978265-42978287 CCACATTCATATTTTCACCTAGG + Intergenic
1096460508 12:51819376-51819398 CCACATTCATGCCTAGGCCTCGG + Intergenic
1097161654 12:57050367-57050389 CAAAATTCCTGACTTCTCTTTGG - Intronic
1097176219 12:57144946-57144968 CCACATTCTTGCCCTTTCCTCGG + Intronic
1097983291 12:65756183-65756205 CCACATTTATGACTTTTATTTGG + Intergenic
1099608380 12:84834152-84834174 CCACTTTTATGACTTCCACTTGG - Intergenic
1101397057 12:104357557-104357579 CCACCTTCCTGTCTTCTCATTGG - Intergenic
1101694245 12:107109539-107109561 CTACATTCAGGGATTCTCCTGGG + Intergenic
1103711125 12:122913498-122913520 CCACCTTTGTGACTGCTCCTTGG - Intergenic
1105738392 13:23296005-23296027 AGACATTCATGAGGTCTCCTCGG - Intronic
1110075836 13:71241369-71241391 TCTAATTCATCACTTCTCCTTGG + Intergenic
1110807064 13:79768045-79768067 GCACATACATGTCTTCTTCTAGG - Intergenic
1110842877 13:80162693-80162715 CAACTTTCATGAATTCTCCCAGG - Intergenic
1110946834 13:81432099-81432121 CCACCTTCATCAATTATCCTAGG - Intergenic
1113872510 13:113568424-113568446 CCACATTCAGGACCTGTCCCAGG - Intergenic
1114157457 14:20120745-20120767 CCAGATCCATGGCTTCCCCTAGG + Intergenic
1114571658 14:23673464-23673486 CCTCATTCCTGAATTCTCCCAGG + Intergenic
1116402180 14:44521458-44521480 CCACCTTCTTGAGTTCTCATAGG - Intergenic
1116429131 14:44825823-44825845 CCACATACATGTCTTCTTTTTGG - Intergenic
1118456902 14:65952861-65952883 CCAGATTCCTGTCTTCCCCTTGG + Intergenic
1119552118 14:75522593-75522615 CTCCCTTCCTGACTTCTCCTGGG - Exonic
1119779001 14:77265865-77265887 CCTCATTCAGCACTTCTGCTGGG - Exonic
1119916217 14:78404510-78404532 CCTCATTCCTGACCTTTCCTTGG - Intronic
1120033080 14:79664727-79664749 CAGCATTCAGGACTTTTCCTGGG - Intronic
1120904152 14:89605041-89605063 CCCCCTTCATCACTTCTCTTAGG - Intronic
1121819290 14:96953334-96953356 ACACAGTCATGATGTCTCCTTGG - Intergenic
1121945472 14:98117080-98117102 CCACAGTCATGTCTTCCACTGGG - Intergenic
1126131307 15:45344288-45344310 CCAAATTCATGAATAGTCCTTGG - Intergenic
1126285095 15:47001197-47001219 ACACATTAATGATTTTTCCTGGG - Intergenic
1127113382 15:55698589-55698611 CCCCATTCATTACTTCTTCTGGG + Intronic
1128555185 15:68626876-68626898 TCAAACTCATGACTTCTCCAGGG - Intronic
1130427272 15:83813863-83813885 TGACATGCATGACTTCTCTTAGG - Intronic
1130686250 15:86040399-86040421 CCTCATTAATGTCTTCTCCAAGG + Intergenic
1131143056 15:89993296-89993318 CCACATTCATGTATTCTTATGGG + Intergenic
1133805239 16:9121707-9121729 CCACATTCCAGAGTTCTCCAGGG - Intergenic
1134116016 16:11549502-11549524 CCACCTTCATGTCTTCTTTTGGG - Exonic
1142441633 16:90102167-90102189 CCACACTGATCACTTCCCCTGGG + Intergenic
1143613802 17:8037772-8037794 CCAAATCCATAACTTCCCCTTGG + Intergenic
1144103279 17:11962799-11962821 CCACATTCATGAGCTCTCAAAGG + Intronic
1147472898 17:40680475-40680497 CCAGATTTTTCACTTCTCCTGGG + Intergenic
1148540514 17:48476850-48476872 CCAAACTCCTGACTTCTCATTGG + Intergenic
1148736950 17:49870259-49870281 CCCCAGACATGGCTTCTCCTGGG - Intergenic
1151601508 17:75109202-75109224 CCACAATCAAGGCTCCTCCTCGG + Intergenic
1158424289 18:57325034-57325056 CCACATTCACTCCTTCTCCATGG + Intergenic
1158982091 18:62773054-62773076 CCACATTCATCTCTTCCCTTTGG - Intronic
1159638122 18:70830643-70830665 CCACATACCTGCCTTCTCATTGG + Intergenic
1160048985 18:75414253-75414275 CCACATTCTTTACATTTCCTTGG - Intronic
1160613122 18:80104515-80104537 CCACTTCCTTGGCTTCTCCTTGG + Intergenic
1160680178 19:408745-408767 CCACATCCGTGTCTTCCCCTGGG - Intronic
1162144917 19:8607688-8607710 CCACATTCCCCACTTCTGCTTGG + Intronic
1162913202 19:13861021-13861043 CCAGAATCCTGACTTCTCCAAGG - Intergenic
1166736319 19:45087440-45087462 GCTCATTCATGAATTCTCATTGG + Intronic
1166930557 19:46298928-46298950 CCACATTCAGGGCTACTTCTGGG - Intronic
1167017043 19:46848017-46848039 CCACTTTCATGACTTAACTTTGG + Intronic
1167861809 19:52290431-52290453 CCACATTCATGACATCTGTTAGG - Exonic
1167872597 19:52385219-52385241 CCACATTCATGACATCTGTACGG - Exonic
1168429839 19:56269750-56269772 CCACATTCCTGACTCCTGGTCGG - Intronic
1202687833 1_KI270712v1_random:62541-62563 GCACATTCTTGTATTCTCCTGGG + Intergenic
926397204 2:12455606-12455628 CCAGATTCATGACTTGACCCGGG + Intergenic
927935714 2:27075120-27075142 AAACATTCATGACAGCTCCTAGG + Intergenic
928103697 2:28453954-28453976 CCACTTTGAAGACTTCTCTTTGG + Intergenic
932570379 2:72935385-72935407 CCACTTCCAGGACTTCTCTTTGG + Intronic
932968072 2:76501945-76501967 CCACATTCATGCCTTTGCTTGGG - Intergenic
933886471 2:86722385-86722407 CCACAGTCTTGAATTTTCCTTGG + Intronic
933923709 2:87074320-87074342 CCACAGTCTTGAATTTTCCTTGG - Intergenic
933958520 2:87393055-87393077 GCACATTCTTGTATTCTCCTGGG - Intergenic
934242650 2:90285024-90285046 GCACATTCTTGTATTCTCCTGGG - Intergenic
934270526 2:91531638-91531660 GCACATTCTTGTATTCTCCTGGG + Intergenic
936929241 2:117770007-117770029 CCACATTATTGACTTATCCATGG - Intergenic
939349653 2:141018587-141018609 CCACATTTATGTCATCTCTTGGG + Intronic
942664538 2:178303683-178303705 CCACAGTCATGACTTTCCCATGG + Intronic
942828624 2:180211357-180211379 CCACTTCCATGCCTACTCCTGGG + Intergenic
943616748 2:190101305-190101327 CTACAGTTATGGCTTCTCCTCGG + Intronic
943816242 2:192259605-192259627 CCATTTTCTTGAGTTCTCCTTGG + Intergenic
944665179 2:201953763-201953785 CCAAATCCTTGACTTGTCCTGGG + Intergenic
946291149 2:218746333-218746355 ACACCTTCCTGACTTCTCCATGG - Intronic
946441594 2:219701583-219701605 TCACCTTCATGCCGTCTCCTGGG + Intergenic
946555748 2:220855233-220855255 CCAAATTCAGGACTTAGCCTTGG - Intergenic
947462886 2:230318463-230318485 CCACACTCAGGCCTGCTCCTGGG - Intergenic
1169618504 20:7477506-7477528 ACATATTCATGACTTCTGCATGG + Intergenic
1173353361 20:42264797-42264819 CCTGATTCATGACTTCTATTTGG + Intronic
1173532070 20:43777553-43777575 CCACAGGCATGACTTCTTCAAGG - Intergenic
1175478831 20:59297169-59297191 CCTGATACATGACTTCTCCTAGG + Intergenic
1178229247 21:30762161-30762183 CGTCATTCCTGAATTCTCCTAGG + Intergenic
1182872568 22:33661644-33661666 CCCCATTCATTCCTGCTCCTTGG + Intronic
1183165021 22:36140999-36141021 CAGCATTCCTGCCTTCTCCTTGG + Exonic
950103422 3:10372818-10372840 CCACACTCATACCTTCTTCTAGG + Intronic
950463658 3:13140571-13140593 CCACGTTGATGACTTCTCCATGG - Intergenic
952838314 3:37623515-37623537 CCACATTCTTTCCTTCTCTTTGG + Intronic
957422201 3:79985832-79985854 GCACATTCATGAATGCTTCTTGG - Intergenic
957503134 3:81083165-81083187 CCATTTTCCTTACTTCTCCTGGG + Intergenic
960368212 3:116801242-116801264 TCATATTCATGACTTTTTCTCGG + Intronic
960397777 3:117158297-117158319 GCAAATCCATGCCTTCTCCTTGG + Intergenic
961401758 3:126651826-126651848 CTACATTCTTGACGTCTACTTGG - Intronic
962933863 3:140061447-140061469 CCACAGCCATGAGGTCTCCTAGG - Intronic
963163460 3:142176571-142176593 ACAAAATCAAGACTTCTCCTAGG + Intronic
968361891 3:198153146-198153168 CCACACTGATCACTTCCCCTGGG + Intergenic
969118464 4:4889291-4889313 GCAGAATCCTGACTTCTCCTTGG - Intergenic
972935341 4:44127968-44127990 CCACATTCATTTCTTCTCACAGG - Intergenic
976936576 4:90643331-90643353 CCAGATTCAGGATTTGTCCTGGG + Intronic
977718645 4:100212596-100212618 CCACATTCCTGGCTTCACCCTGG - Intergenic
980328926 4:131386078-131386100 CCACATACATGTCTTCTTTTAGG + Intergenic
983565224 4:169143591-169143613 CCACATTTCTGACGCCTCCTGGG + Intronic
986057148 5:4149321-4149343 CCAGATTCATCATGTCTCCTAGG + Intergenic
987382883 5:17302214-17302236 ACACTTTCTTGACTTGTCCTTGG + Intergenic
988103668 5:26714683-26714705 CCACATTAATGATTTTACCTTGG - Intergenic
990212067 5:53491524-53491546 CCGATTTGATGACTTCTCCTGGG - Intergenic
993162173 5:84306128-84306150 CCTCATTCATGACTATTCCTAGG - Intronic
996246194 5:121266295-121266317 CCAAATTTATGATTTCTGCTGGG + Intergenic
997483987 5:134213052-134213074 CCACCTTCATCACTTATCTTAGG - Intronic
998365149 5:141625614-141625636 CCACATCTTTGACCTCTCCTGGG + Intronic
998898151 5:146822451-146822473 CCACATTCATTACTGCTCCAGGG + Intronic
1000277645 5:159752917-159752939 CCACACCCATGGCTTCCCCTGGG + Intergenic
1000863092 5:166479743-166479765 GAACATTGATGACATCTCCTAGG + Intergenic
1004126898 6:12882920-12882942 CCCCATTAATCACTTCTCCATGG - Intronic
1004790641 6:19022433-19022455 CCACATGCTTGTATTCTCCTCGG + Intergenic
1005402347 6:25447873-25447895 CAACATCCATGACTTCACCTAGG + Intronic
1005656928 6:27948403-27948425 CCACAATCATCACTTCTTTTTGG + Intergenic
1006455167 6:34127708-34127730 CCACTTTCAGAACTTGTCCTGGG - Intronic
1006645447 6:35511940-35511962 CCACTTTCAACACTTCTCCCCGG + Intronic
1007424747 6:41739731-41739753 AGGCATTCATGATTTCTCCTGGG - Intronic
1008002497 6:46375334-46375356 CCACATTTATCACTTATGCTTGG + Intronic
1011736024 6:90311343-90311365 CCACATTCCTCAGTTTTCCTGGG - Intergenic
1012041967 6:94217824-94217846 CCACAGTCAGGATTTCTCCAGGG - Intergenic
1012064138 6:94526848-94526870 GCACATTTATGACCTCACCTTGG + Intergenic
1016744090 6:147559471-147559493 CTTCATTCATGACTTCTCTGCGG - Intronic
1019253792 7:35579-35601 CCACACTGATCACTTCCCCTGGG - Intergenic
1019953069 7:4389537-4389559 CCACATAAATGTCTTCTCTTGGG + Intergenic
1019960135 7:4452163-4452185 TCACATTCAAGATTACTCCTTGG + Intergenic
1020712519 7:11626016-11626038 TCACTTTCATCACTTTTCCTGGG - Intronic
1021275205 7:18641684-18641706 CCAGATTCAAAACTTCTTCTTGG + Intronic
1022624644 7:32022479-32022501 CCACATTCATGACTTCTCCTTGG - Intronic
1023254574 7:38300302-38300324 GCACTTTCCTGCCTTCTCCTTGG - Intergenic
1023652665 7:42388148-42388170 CCACACTAATGGCTTCTCCGTGG + Intergenic
1023824471 7:43999873-43999895 CTCCACTCCTGACTTCTCCTAGG + Intergenic
1024894461 7:54241715-54241737 CCACATTCAAGATTACTACTGGG + Intergenic
1026088020 7:67278637-67278659 CTCCACTCCTGACTTCTCCTAGG + Intergenic
1026267231 7:68806060-68806082 CCACCTTCATCAGCTCTCCTGGG + Intergenic
1027117623 7:75493971-75493993 CTCCACTCCTGACTTCTCCTAGG + Intergenic
1027274180 7:76541514-76541536 CTCCACTCCTGACTTCTCCTAGG - Intergenic
1027327624 7:77060567-77060589 CTCCACTCCTGACTTCTCCTAGG - Intergenic
1029299933 7:99573568-99573590 TTACATTCATGAGTTCTCTTTGG - Exonic
1030491682 7:110243595-110243617 CCAGATTCTTGATTTTTCCTAGG - Intergenic
1033825602 7:145186313-145186335 CCCCATTCATTACTTGTCCATGG + Intergenic
1034049401 7:147966498-147966520 CCTAATTCATGACTTCTGTTTGG - Intronic
1035369032 7:158367129-158367151 CCACAGAGCTGACTTCTCCTCGG + Intronic
1035577849 8:719325-719347 CCACCATCATGACATCTCTTGGG + Intronic
1035627987 8:1088215-1088237 CAATATTCATTGCTTCTCCTTGG + Intergenic
1037890940 8:22623396-22623418 CCACAATCAGGGCTGCTCCTAGG - Intronic
1038407429 8:27332379-27332401 CCAAATTCATCACTTTTCCTGGG - Intronic
1039819771 8:41125306-41125328 CTACATTTATGACATCGCCTTGG + Intergenic
1040919941 8:52605003-52605025 CCACATTCATGCCTTATACTGGG + Intergenic
1041691693 8:60693671-60693693 CCACATTCCTGACATCTGATTGG + Intronic
1044625118 8:94229216-94229238 CCACATACATGGCTTTTACTGGG + Intergenic
1045406916 8:101875752-101875774 CCACATTCAGGACCCCTCCCTGG + Intronic
1046171222 8:110509324-110509346 CCACATTTCTGTCTTCTGCTTGG + Intergenic
1048213988 8:132479839-132479861 GCACATTTATGACATCTTCTAGG - Intronic
1050024616 9:1321011-1321033 CTACCTTCATGGCTTCTCCCTGG + Intergenic
1052749449 9:32474490-32474512 CCACAGTCATAACTTCATCTTGG - Intronic
1052938116 9:34110408-34110430 CCTCACTCATCACTTCTCCTTGG + Intronic
1056591229 9:87967527-87967549 CCACATCCATGACTTCCACGTGG - Exonic
1059567297 9:115395670-115395692 CCTCATTCCTGGCTCCTCCTTGG - Intronic
1059687388 9:116650671-116650693 CCAAACCCATGTCTTCTCCTAGG + Intronic
1062436318 9:136548023-136548045 CCTCATCCCTGGCTTCTCCTCGG - Intergenic
1062746606 9:138216964-138216986 CCACACTGATCACTTCCCCTGGG + Intergenic
1192035599 X:67559523-67559545 CCACATTCATGACTTCCTATGGG - Intronic
1198720612 X:139615267-139615289 CCAATTTCATGACTGCTTCTTGG - Intronic
1200756874 Y:6998308-6998330 CCACATTCATGCCCTCTCTTTGG + Intronic