ID: 1022624655

View in Genome Browser
Species Human (GRCh38)
Location 7:32022518-32022540
Sequence GGGGAATGAAGTGGTTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022624643_1022624655 17 Left 1022624643 7:32022478-32022500 CCCAAGGAGAAGTCATGAATGTG 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1022624655 7:32022518-32022540 GGGGAATGAAGTGGTTTAAGGGG No data
1022624644_1022624655 16 Left 1022624644 7:32022479-32022501 CCAAGGAGAAGTCATGAATGTGG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1022624655 7:32022518-32022540 GGGGAATGAAGTGGTTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022624655 Original CRISPR GGGGAATGAAGTGGTTTAAG GGG Intronic
No off target data available for this crispr