ID: 1022626812

View in Genome Browser
Species Human (GRCh38)
Location 7:32045081-32045103
Sequence GCTAATGTATCAGCAGGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022626812_1022626816 19 Left 1022626812 7:32045081-32045103 CCGACTCCTGCTGATACATTAGC 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1022626816 7:32045123-32045145 ACTAAGTAGTGAATGAGTGATGG 0: 1
1: 0
2: 1
3: 11
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022626812 Original CRISPR GCTAATGTATCAGCAGGAGT CGG (reversed) Intronic
904023002 1:27482844-27482866 GCTACTGTATCAATAGGGGTAGG - Intronic
904404165 1:30275246-30275268 GCCAAGGTATCAGCTGCAGTGGG - Intergenic
905231161 1:36515661-36515683 GCCAAGGTCTGAGCAGGAGTGGG - Intergenic
909612719 1:77569991-77570013 CCTAATGTAGCAGGAGGAATGGG - Intronic
910121066 1:83791116-83791138 GCTAATGGGTCAACAGGAGATGG + Intergenic
910541624 1:88364983-88365005 GGTAATATATCAACAGGAATTGG - Intergenic
916691906 1:167198077-167198099 TCTTATGTATCAGCTGCAGTTGG + Intergenic
916926615 1:169528038-169528060 GAAAATGTATGAGCAAGAGTGGG - Exonic
921517316 1:216111380-216111402 GTTAATGTATCCGAAGGAGAAGG - Intronic
921982475 1:221273597-221273619 GCTAAAATCTCATCAGGAGTTGG + Intergenic
922578527 1:226679995-226680017 GCCAAAGTGTCAGCAGCAGTAGG - Intronic
923660696 1:235954744-235954766 GCAAATGGCTCAGCAGGAGACGG - Intergenic
1065760877 10:28982360-28982382 GCTAATGCAGTAGAAGGAGTTGG - Intergenic
1068322034 10:55432161-55432183 GTTAATATTTCAGCAGGAATTGG + Intronic
1069265952 10:66457766-66457788 GATGATGTATCATCAGTAGTGGG + Intronic
1070392830 10:75985963-75985985 GCTCTTGTATCAACAGGAGTTGG + Intronic
1072789659 10:98309098-98309120 GGTGAGGTATCTGCAGGAGTTGG - Intergenic
1074045905 10:109838841-109838863 GTTGATGTAGCAACAGGAGTGGG - Intergenic
1077159710 11:1107234-1107256 GGTAATGTTGCAGCAGGTGTCGG - Intergenic
1079036205 11:17022329-17022351 TTTTATGTATCAACAGGAGTAGG - Intergenic
1082041214 11:47686606-47686628 GCTCATGTATCACCAGGGGATGG - Intronic
1084603137 11:70158463-70158485 GTTTCTGTATCAGCAGGAGGGGG - Intronic
1084936287 11:72588665-72588687 GCTACTGTCTCAGCAGCAGTGGG - Intronic
1086398310 11:86440148-86440170 GCTGAGGTAGCAGCAGGAGTAGG + Intergenic
1093985584 12:25528761-25528783 GCTGAAGCATCAGGAGGAGTTGG - Intronic
1096412613 12:51388148-51388170 GGGAATGAATCAGCAGGACTTGG - Intronic
1096865038 12:54557600-54557622 GATTATGGATCAGCAGGATTTGG - Intronic
1100312558 12:93410787-93410809 GCTAATGGATCATCTGGATTGGG + Exonic
1102670986 12:114618778-114618800 GCTAATGTTTTAGCAGAAATGGG - Intergenic
1106931946 13:34675882-34675904 GATAATGTATCAGCAGCTGCTGG + Intergenic
1108518564 13:51224097-51224119 GCTCTGGTGTCAGCAGGAGTGGG - Intronic
1108816577 13:54299111-54299133 GAGAATGTATCAGCAGCTGTTGG + Intergenic
1110466326 13:75806318-75806340 GCTAATGGAGCAGCAGAAGCAGG - Intronic
1111666066 13:91270043-91270065 GCTATTGAAACAGTAGGAGTTGG - Intergenic
1111889181 13:94060312-94060334 GCTTATATTTCAGCAGGGGTGGG - Intronic
1113670945 13:112175798-112175820 GCCCATGTGTCACCAGGAGTGGG + Intergenic
1114328327 14:21612018-21612040 GCTAATGGATCATCTGGATTGGG + Intergenic
1114893805 14:26960415-26960437 GATAATGCATCAGCAGCACTGGG - Intergenic
1120646707 14:87082871-87082893 GCTTATGTATGAGGAGGAGGAGG - Intergenic
1121567544 14:94922166-94922188 ACTTATGTAACATCAGGAGTAGG - Intergenic
1125211231 15:37217590-37217612 GCTAATACATTAGCTGGAGTAGG + Intergenic
1128211200 15:65903886-65903908 GCAAATGTACCAGCAGGTGTTGG - Intronic
1130694424 15:86116381-86116403 GCTAATGTGTCAGCTTGAGTGGG + Intergenic
1135792416 16:25409339-25409361 CATAATGTATGAGCAGGACTGGG + Intergenic
1137977003 16:53040479-53040501 GCGAATGTATGACCTGGAGTTGG - Intergenic
1139204428 16:65013426-65013448 GCTCAGGAATCAGAAGGAGTTGG + Intronic
1143408389 17:6693299-6693321 GCTAATTTATAAGTAGGAGATGG - Intronic
1144573175 17:16413248-16413270 GATGATGGATGAGCAGGAGTTGG + Intergenic
1146130939 17:30274640-30274662 ACTAATTTTTCAGCTGGAGTTGG + Intronic
1147659167 17:42108000-42108022 GCAAATGTATGAGCAGCAGGTGG - Exonic
1149201519 17:54191090-54191112 GCTAGGGTTTCAGTAGGAGTTGG - Intergenic
1152650878 17:81492093-81492115 GCTAAAGCAGCAGCAGGAGCAGG + Intergenic
1154046255 18:10907900-10907922 ACTAATGTAGTACCAGGAGTGGG + Intronic
1156312256 18:35935526-35935548 GTTAGTGCATCAGCAGAAGTGGG - Intergenic
1156800080 18:41099989-41100011 GCTAATGTATCACTATAAGTTGG + Intergenic
1158570814 18:58595722-58595744 GGTAATGTATAGCCAGGAGTGGG + Intronic
1158624532 18:59059765-59059787 GCTAAAGAATCAGAAGGAATTGG + Intergenic
1159944081 18:74430690-74430712 ACTCATGTATCAGCAGGTTTGGG - Intergenic
925964704 2:9053164-9053186 TCTAAAGTATCAACAGGTGTGGG + Intergenic
928133676 2:28672083-28672105 GCGAAATTTTCAGCAGGAGTGGG + Intergenic
929311468 2:40431070-40431092 GCTAATGTATCAGCAGACCTGGG - Intronic
934044819 2:88164245-88164267 GTTGATGTTCCAGCAGGAGTTGG + Intergenic
938788918 2:134659533-134659555 GCTAACGTGCCAGCAGGAGATGG - Intronic
940865926 2:158817812-158817834 GCTAATGTAACAGCAGAAGAAGG + Intronic
941915050 2:170806339-170806361 GATAAAACATCAGCAGGAGTTGG + Intergenic
948748625 2:240113767-240113789 GCTTAGGTGTCAGCAGGAATAGG + Intergenic
1170427747 20:16252207-16252229 GCCAAGGTTTCTGCAGGAGTAGG + Intergenic
1171485699 20:25483983-25484005 GCAAATGTCCCAGCAGAAGTGGG - Intronic
1173785477 20:45790043-45790065 GCTGAGGTATGAGCAGGACTAGG + Intronic
1181931455 22:26405057-26405079 GCTAATGGCTCAGCAGGATTAGG - Intergenic
1183070432 22:35392390-35392412 CCTAATGCATCAGAAGGAGCAGG + Intronic
1184024479 22:41844869-41844891 ACAAATGTATCAGGAGGACTTGG - Intronic
1184445521 22:44544783-44544805 GCTCAGGTATCAGCAGGACATGG - Intergenic
1184988883 22:48154314-48154336 GCTGAGGTATCAGCAGGGGATGG - Intergenic
950875427 3:16267145-16267167 CCTAATGTATCAGCAAGTTTTGG + Intronic
951244932 3:20330185-20330207 GCTAATCTTTCAGCAGCAGCTGG - Intergenic
952005778 3:28840995-28841017 GCTGATCTATCAGCAGGACTCGG + Intergenic
952160220 3:30685845-30685867 GCTTATGTAGCAGCTGCAGTTGG - Intronic
957024579 3:75166996-75167018 TCTCATGTATCAGCAGGAACAGG - Intergenic
957954707 3:87170680-87170702 GGCAATGTATCAGCAGGCGTAGG - Intergenic
960022989 3:112976438-112976460 TCTAATGTTTCACCAGGTGTCGG + Intergenic
967327793 3:188259415-188259437 GTTAATGTCTCAGCAGGATCGGG - Intronic
979887895 4:126054168-126054190 GCTCATATCTCAGCAGAAGTTGG + Intergenic
983374845 4:166912831-166912853 TCTAATGTATCTTCAGGAGTTGG - Intronic
983835639 4:172380123-172380145 GCTAATGGATCATCTGGATTTGG + Intronic
983963469 4:173782331-173782353 GCAAAGATTTCAGCAGGAGTTGG + Intergenic
986199894 5:5570870-5570892 ACAAATGACTCAGCAGGAGTGGG + Intergenic
987924271 5:24319813-24319835 GTTAGTGTATAAGTAGGAGTAGG + Intergenic
992062504 5:73068689-73068711 GCTAATGGTGCAGCAGGAGGTGG - Exonic
998834441 5:146190314-146190336 GCTAATGGGTCAGCAGAGGTAGG + Intergenic
999295505 5:150457294-150457316 GCAAATGTGGCAGCAGGAGCTGG + Intergenic
1005856008 6:29863890-29863912 GCTCATAGAGCAGCAGGAGTTGG - Intergenic
1006237218 6:32644137-32644159 GACAATGTAGCAGCAGCAGTGGG + Intronic
1006247231 6:32747971-32747993 GACAATGTAGCAGCAGTAGTGGG + Intergenic
1006501613 6:34462885-34462907 GCTAATGTATTAGTAGGGGAGGG + Intergenic
1007831248 6:44640081-44640103 GCTAATGTGTTAGCAGGACCAGG + Intergenic
1007879551 6:45148411-45148433 CCTAATGTATCAGTTGGATTGGG - Intronic
1012522043 6:100133692-100133714 ATTAATGTGTGAGCAGGAGTTGG - Intergenic
1012950245 6:105510513-105510535 GCTAATCTGTCAGGAGGAGTGGG + Intergenic
1013896573 6:115096038-115096060 GTTAGTGTATAAACAGGAGTTGG - Intergenic
1014331606 6:120073934-120073956 GCTCATGTATAAGCAGAAATAGG - Intergenic
1016869001 6:148798332-148798354 GCTAATATATGAAGAGGAGTGGG + Intronic
1018961196 6:168450031-168450053 GCTTATCTATCAGGAGGAGGAGG + Intronic
1019235137 6:170605584-170605606 GATCATCTAACAGCAGGAGTTGG - Intergenic
1020417445 7:7962151-7962173 GGAGATGTATCAGCAGGAATGGG + Intronic
1022311051 7:29195817-29195839 GCTAATGAATCTGAAGGAGTAGG + Intronic
1022626812 7:32045081-32045103 GCTAATGTATCAGCAGGAGTCGG - Intronic
1022802868 7:33792531-33792553 ACTGATGTTGCAGCAGGAGTGGG - Intergenic
1026373496 7:69725838-69725860 GTTAATGTACCTGCAGGATTTGG + Intronic
1028645989 7:93097383-93097405 TCTATTGGAGCAGCAGGAGTGGG + Intergenic
1029278576 7:99422489-99422511 CCTCCTGTATCAGCAGGAGCAGG - Intronic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1053531756 9:38889088-38889110 GGTAGTTTATCAGCAGGAGTAGG + Intergenic
1053779604 9:41592155-41592177 GCTAAAGTATCAACATTAGTAGG + Intergenic
1054167560 9:61802396-61802418 GCTAAAGTATCAACATTAGTAGG + Intergenic
1054203979 9:62113516-62113538 GGTAGTTTATCAGCAGGAGTAGG + Intergenic
1054634383 9:67474849-67474871 GGTAGTTTATCAGCAGGAGTAGG - Intergenic
1054669982 9:67778504-67778526 GCTAAAGTATCAACATTAGTAGG - Intergenic
1054883626 9:70172123-70172145 TCTAATGTCTCAACAGGACTGGG - Intronic
1055528263 9:77156843-77156865 GCTAGGGTATAAGCAGGAGGAGG - Intergenic
1058899616 9:109430852-109430874 GCTAGTGAGTCAGGAGGAGTGGG - Intronic
1060397566 9:123326799-123326821 GCTACTGGCTCAGAAGGAGTGGG - Intergenic
1061294778 9:129671187-129671209 GATCATGTCTCAGCAGGAGCCGG + Intronic
1190593137 X:52025716-52025738 GCCCAGGTATCAGCAGCAGTCGG + Intergenic
1191085165 X:56558854-56558876 CCAAATGCATCAACAGGAGTAGG + Intergenic
1194312104 X:92323746-92323768 GCAAATGTATCAGAGGGAGGTGG - Intronic
1195012879 X:100750828-100750850 GCTACTGTATCATCATGAGGTGG + Intergenic
1195814063 X:108866545-108866567 GCAAAAGAATCAGCAGGATTTGG - Intergenic
1196840592 X:119855480-119855502 GGTAATGTTACAGCAGGAATAGG - Intergenic
1197871044 X:131063178-131063200 TCACATGTATCAGCAGAAGTAGG + Intronic
1198152240 X:133922560-133922582 AGTAATTTAGCAGCAGGAGTGGG + Intronic
1199107248 X:143884446-143884468 GCTAATGGATCATCTGGATTGGG - Intergenic
1201191586 Y:11448164-11448186 GCTAAAGTTTGAGCAGGAGCAGG + Intergenic