ID: 1022627818

View in Genome Browser
Species Human (GRCh38)
Location 7:32056163-32056185
Sequence GGGACCTGGCAAATTTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022627812_1022627818 24 Left 1022627812 7:32056116-32056138 CCAAGCTGATGTAGAAAGTAGAG 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1022627818 7:32056163-32056185 GGGACCTGGCAAATTTGGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022627818 Original CRISPR GGGACCTGGCAAATTTGGCA GGG Intronic
900001458 1:17051-17073 GGGACCTGCAAGATTAGGCAGGG + Intergenic
900021177 1:187573-187595 GGGACCTGCAAGATTAGGCAGGG + Intergenic
903191141 1:21656768-21656790 GGGACCAGGAAAATCTGGCCTGG + Intronic
903649839 1:24915835-24915857 GACACCTGGCAAGTCTGGCATGG - Intronic
905027293 1:34859563-34859585 GGGAGCTGGCAGATCTGGCCGGG + Intronic
905355482 1:37380857-37380879 GGGACCTGCCAAGTGTGGCACGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906317100 1:44793456-44793478 GGAACTTGGCAAATTGGGGAAGG + Intergenic
906933578 1:50192316-50192338 GGGACCTGGCATGTCTGTCATGG + Intronic
907486148 1:54779589-54779611 GGTACCTGTGAAATATGGCAGGG - Intergenic
910802119 1:91157465-91157487 GGGACCAGGCCAGCTTGGCATGG - Intergenic
912234792 1:107837970-107837992 GGGACCTGGCAAATAATTCATGG + Intronic
912361006 1:109094937-109094959 TGGATCTGGCAAATTGGGGAGGG + Exonic
912630313 1:111241318-111241340 AGGAACTGGCAGATCTGGCAGGG - Exonic
918537172 1:185586729-185586751 GGGACTTGCCAAGTCTGGCATGG - Intergenic
1066699926 10:38116403-38116425 TGAACCTGGGAAATTTGGGAAGG + Intronic
1067127618 10:43533274-43533296 GGGACCTGCCAAACCAGGCACGG + Intergenic
1069219881 10:65869817-65869839 GGGACCAGGCAATTGTGGCATGG + Intergenic
1071508432 10:86246608-86246630 GGGACCTGGAAAAGGAGGCAGGG - Intronic
1071589908 10:86862872-86862894 AGGATCTAGCAAATTTGGGAGGG + Intronic
1075481995 10:122789851-122789873 GTGTCCTGGCAAATGTGCCATGG - Intergenic
1075561532 10:123472207-123472229 GGGTCATGGCTACTTTGGCATGG - Intergenic
1080417926 11:32086927-32086949 GTGACCTGGCAACTCTGCCAAGG + Intronic
1080937013 11:36874814-36874836 GGGAGCTGGCAAAATTTACAGGG + Intergenic
1082686582 11:56245501-56245523 GGGCCCTGGGATATTTGGAATGG + Intergenic
1086362877 11:86077530-86077552 AGGACCTGCCATCTTTGGCAGGG - Intergenic
1087064694 11:94016667-94016689 GGGTCCTGGGACATTTGGAATGG - Intergenic
1090437007 11:126695489-126695511 GGGACTTGGGAAATGTGGCAGGG - Intronic
1090456931 11:126858059-126858081 GGCTCCTGGCACATTTGGCGAGG - Intronic
1090868222 11:130720773-130720795 GAGACCTGGGAGACTTGGCAGGG + Intergenic
1091374543 12:17166-17188 GGGACCTGCAAGATTAGGCAGGG + Intergenic
1102730837 12:115107850-115107872 GAGACCTGCCCAAGTTGGCAGGG + Intergenic
1110071547 13:71184612-71184634 GGGACCTGCCAAGCTAGGCATGG - Intergenic
1110885574 13:80629868-80629890 AGTACCTGACAAATTGGGCATGG + Intergenic
1111345762 13:86951242-86951264 GAGACAGGGCAAATTTGGAAAGG - Intergenic
1111349088 13:87002411-87002433 GGGACCTGAGATGTTTGGCATGG + Intergenic
1114892669 14:26944927-26944949 GGGACCTGGGAAATGTTGCCAGG + Intergenic
1115453300 14:33573650-33573672 AGGACTTGGCCAATTTGGAAAGG + Intronic
1119681965 14:76599275-76599297 TGCACCTGGCAAATGTGGCTTGG - Intergenic
1120711059 14:87793495-87793517 GGGATCAGGCTACTTTGGCAAGG + Intergenic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1125170067 15:36756863-36756885 GGGCCCTGGCTAATTTGACATGG + Intronic
1130741591 15:86606311-86606333 GCTCCCTGGTAAATTTGGCAAGG + Intronic
1132452051 15:101973887-101973909 GGGACCTGCAAGATTAGGCAGGG - Intergenic
1132454843 16:16734-16756 GGGACCTGCAAGATTAGGCAGGG + Exonic
1133200081 16:4198784-4198806 GGGCACTGGCAAATTTGTCATGG - Intronic
1135642872 16:24136155-24136177 GAGACCTGGAAAATTCGGGAAGG - Intronic
1140795968 16:78438501-78438523 TGGACCTGGGAACTCTGGCAAGG - Intronic
1141510247 16:84507207-84507229 TGGACATGGAAAATTGGGCAGGG - Intronic
1145861207 17:28211886-28211908 GGGACCTGCCAAGTCAGGCACGG - Intergenic
1145875201 17:28314038-28314060 GGCAAGTGGCCAATTTGGCATGG + Intergenic
1146317684 17:31821042-31821064 GGGACGTGGCAAAGTCAGCAAGG - Intergenic
1148042123 17:44716238-44716260 GGGACCTGGCAATTTTGTGGGGG + Intronic
1148860180 17:50600538-50600560 GGGGCCTGGCAAGGTTGACAGGG + Intronic
1149438383 17:56653626-56653648 TGGACATGGCAAGGTTGGCATGG - Intergenic
1152097217 17:78279097-78279119 GGGACATGGCAGAGTGGGCAGGG + Intergenic
1153582738 18:6591310-6591332 AGGACCTGGCAAACTTGAGATGG + Intergenic
1156375403 18:36510944-36510966 GGGACCAGGTAAATGTGGCCAGG - Intronic
1159667676 18:71182590-71182612 GGTACCTGCCCATTTTGGCAAGG + Intergenic
1161335818 19:3712651-3712673 GGGAAATGGCATCTTTGGCATGG + Intronic
1164821396 19:31254114-31254136 GGCACCTGGCAGATTTTGAATGG + Intergenic
1168234119 19:55051264-55051286 GGGACCGGGAAAATGAGGCAGGG + Intronic
925406443 2:3608529-3608551 TGCACCTGGCCAATTTGGCAAGG - Intronic
926203061 2:10814980-10815002 GTGACCTGGGATATTTAGCAGGG - Intronic
928254069 2:29706855-29706877 GGGACTTGGCCAAGGTGGCATGG + Intronic
933515075 2:83290268-83290290 GGGAACTGACAAAGTTTGCAGGG + Intergenic
934153702 2:89174721-89174743 CCAACCTGGCAAATATGGCAGGG - Intergenic
934855729 2:97728431-97728453 GGCTCCTGGAAAATTAGGCAAGG + Intronic
935094252 2:99928828-99928850 GGGACCTGTCAAATTAGTCCAGG + Intronic
936568267 2:113596363-113596385 GGGACCTGCAAGATTAGGCAGGG - Intergenic
942717462 2:178909596-178909618 TGGAACTGGCAAATTCTGCATGG - Intronic
942958721 2:181804361-181804383 GGGACCTGCCAAGTCAGGCATGG + Intergenic
946517426 2:220428541-220428563 GGGACCTGATAGATTTGGGATGG - Intergenic
946644922 2:221823178-221823200 GGCACCTGGGAAAACTGGCATGG - Intergenic
948048499 2:234961828-234961850 GGAACTGGGCAAAGTTGGCATGG - Intronic
948934923 2:241157640-241157662 AGGACCTGGAGAATGTGGCAGGG - Intronic
1170233805 20:14079820-14079842 GGTACCTGGCTTATTGGGCAGGG + Intronic
1170953769 20:20959651-20959673 GGGAGCTGGCAAGCATGGCAAGG + Intergenic
1176247088 20:64102472-64102494 GGGACCAGGCAGATCCGGCACGG - Intergenic
1179282180 21:39943174-39943196 ATGACCTGGGAAATTTGTCAAGG - Intergenic
950679180 3:14573353-14573375 GGGACCTGGAGAAGCTGGCAGGG - Intergenic
952088473 3:29854679-29854701 ATTACCTGGCAAATTTGACAGGG + Intronic
957885544 3:86282559-86282581 GGGACCAGGCACATGTAGCAGGG - Intergenic
963273007 3:143303790-143303812 TGGGCCTGGCAAGTTTTGCAAGG - Intronic
963939077 3:151082881-151082903 GGGACCAGGAAAAATTTGCATGG - Intergenic
964868588 3:161288966-161288988 GGGAGCTGGCAAAGTTACCACGG + Intergenic
965163848 3:165169596-165169618 GGGACCTGCCAAACCGGGCATGG + Intergenic
965452569 3:168857069-168857091 GGGACCTCCCAAATCTGGAATGG - Intergenic
967445296 3:189558910-189558932 GGGGGCTGGCAAATATGGAAGGG + Intergenic
968386892 4:148415-148437 GGGATTTGGCCAATTTGGCCAGG - Intronic
969863229 4:10054004-10054026 GGGCCCTGGCTGATGTGGCAGGG - Intronic
973732241 4:53833674-53833696 GGGACCTGGTGAACTAGGCATGG - Intronic
975070965 4:70137471-70137493 GGGAACTGGCAAATTTAGTTTGG - Intronic
978637923 4:110833065-110833087 TGCACCTGCCAACTTTGGCATGG + Intergenic
978928940 4:114287361-114287383 GGGACCTGTCAAGTCAGGCACGG - Intergenic
980210257 4:129778392-129778414 TGCACCTGGCCAAGTTGGCAAGG - Intergenic
982578813 4:157152593-157152615 GGGACCTGACAAATTGTTCATGG + Intronic
983960691 4:173749924-173749946 GGAAACTGGGAAATTTGTCATGG - Intergenic
984169382 4:176342938-176342960 AGGAACTGCCAAATATGGCAGGG - Intergenic
986127099 5:4893365-4893387 GGGACCTGCCAAACCAGGCACGG + Intergenic
990311753 5:54546976-54546998 GGGACCTGGCATATCTTGCAAGG + Intergenic
993877931 5:93329851-93329873 GGGAGAAGGCAAATTTGGGATGG - Intergenic
997271229 5:132540034-132540056 GGGACCTGGCAGATTGGTGAGGG + Intergenic
997438178 5:133890142-133890164 GGGCCCTGGAATATTTGGTAAGG + Intergenic
998036365 5:138920414-138920436 GGACACTGGCAAATGTGGCAGGG - Intronic
1000922029 5:167149608-167149630 GAAACCTGACAAATATGGCACGG - Intergenic
1002793652 6:452964-452986 GGGACCTGGGGATGTTGGCAAGG + Intergenic
1003342267 6:5233206-5233228 GTGACTTGGCAAATTTGGGGAGG + Intronic
1004465639 6:15882525-15882547 ATGAGCTGGCAAATTTGGCTTGG - Intergenic
1005755323 6:28920868-28920890 GGGCCCAGGGAAATTGGGCAAGG - Intronic
1007597884 6:43062821-43062843 GGGACGTGGCAAGACTGGCAGGG - Intronic
1009431966 6:63573850-63573872 GGGCCCTTCCAAAATTGGCAGGG - Intronic
1010961513 6:82151243-82151265 GGGACCTGCCAAGCTAGGCATGG - Intergenic
1013163590 6:107569766-107569788 TGCTCCTGGCAATTTTGGCAGGG - Intronic
1017916763 6:158837155-158837177 GGAACCTGGCACAGCTGGCAAGG - Intergenic
1018433204 6:163739508-163739530 GGGACATGAGAAAATTGGCAGGG + Intergenic
1022567791 7:31420878-31420900 GGGACCTGGCAGGTAGGGCAGGG - Intergenic
1022627818 7:32056163-32056185 GGGACCTGGCAAATTTGGCAGGG + Intronic
1035647980 8:1243029-1243051 GGGAGCTGGCAAGTTTGCCTAGG - Intergenic
1037987641 8:23299719-23299741 GGGTCCTGCCACATTTGGAAGGG + Intronic
1045559172 8:103244400-103244422 GGGACCAGGGATATTTGGCCAGG + Intergenic
1046173482 8:110544136-110544158 TGCAGCTGCCAAATTTGGCATGG + Intergenic
1049705808 8:144041446-144041468 AGGTCCTGGCAAGTTTGGCCTGG - Intronic
1049884264 9:17162-17184 GGGACCTGCAAGATTAGGCAGGG + Intergenic
1058652384 9:107188888-107188910 AGTATCTGGCAAATTTTGCATGG - Intergenic
1059855578 9:118393540-118393562 AGGACCTGGAAAATTTGGATAGG + Intergenic
1060107905 9:120885719-120885741 GGGACCTGACAAAAGTGGCATGG - Intronic
1186254352 X:7702857-7702879 GGGCCCTGGCAAATGTGGTGGGG + Intergenic
1186637366 X:11420904-11420926 GAGAGGTGGCAAATTAGGCAAGG + Intronic
1188860052 X:35244879-35244901 GGAACCTGGCACCCTTGGCAGGG + Intergenic
1194111159 X:89836452-89836474 GAGACCTCACAAATTTGGCATGG - Intergenic
1195610013 X:106855751-106855773 GGGACCTGTCAAATTTTAAATGG - Intronic
1200401540 X:156022994-156023016 GGGACCTGCAAGATTAGGCAGGG - Intergenic
1200463819 Y:3491186-3491208 GAGACCTCACAAATTTGGCATGG - Intergenic
1201978418 Y:19879994-19880016 GGGAAGTGGTAAATTTAGCAAGG + Intergenic