ID: 1022629067

View in Genome Browser
Species Human (GRCh38)
Location 7:32068404-32068426
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022629065_1022629067 25 Left 1022629065 7:32068356-32068378 CCAGAGTCTTTAGCTATTTATTC 0: 1
1: 0
2: 1
3: 13
4: 242
Right 1022629067 7:32068404-32068426 AAGAAGAAGAAGAAGTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr