ID: 1022632150

View in Genome Browser
Species Human (GRCh38)
Location 7:32095364-32095386
Sequence CACCCTTCCATGGCCGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022632145_1022632150 -3 Left 1022632145 7:32095344-32095366 CCCATGACAGGCAGATCCAGCAC 0: 1
1: 0
2: 1
3: 17
4: 137
Right 1022632150 7:32095364-32095386 CACCCTTCCATGGCCGGACATGG 0: 1
1: 0
2: 0
3: 8
4: 125
1022632146_1022632150 -4 Left 1022632146 7:32095345-32095367 CCATGACAGGCAGATCCAGCACC 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1022632150 7:32095364-32095386 CACCCTTCCATGGCCGGACATGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022632150 Original CRISPR CACCCTTCCATGGCCGGACA TGG Intronic
900285809 1:1899777-1899799 CACCCAGCCATGGCAGGAAATGG - Intergenic
902176816 1:14656663-14656685 CAGTCTTACATGGCCGGAGAAGG + Intronic
903330258 1:22593508-22593530 CACCGTCCCGTGGCAGGACAAGG + Exonic
906102262 1:43271145-43271167 TACCCCTCCAAGGCAGGACAGGG - Intronic
906232662 1:44179032-44179054 CACTCTTCCTTGGCCAGGCATGG + Intergenic
911424067 1:97684773-97684795 CACCCTCCCAAGGCTGAACAAGG + Intronic
913018970 1:114767429-114767451 TACACTTCAATGGCTGGACAAGG - Intergenic
915724297 1:158006934-158006956 CACCCTGGCAAGGCGGGACAAGG - Intronic
917737733 1:177935966-177935988 CAGTCTTCCATGGCAGGACAGGG + Intronic
924610802 1:245572247-245572269 CACCCTTTCATGCCTGGTCAGGG + Intronic
1066263178 10:33748769-33748791 TGCACTTCCATGGGCGGACATGG + Intergenic
1076444130 10:130500327-130500349 CTCCCTTCCATCTCCTGACAGGG + Intergenic
1082005460 11:47416517-47416539 CGGCCTTCCATGGCCAGGCAGGG + Intergenic
1085027196 11:73243153-73243175 CACCCTTCCATGTCCTTCCACGG - Intergenic
1086074308 11:82834083-82834105 CACCCTTACATGGCTGGAGGTGG - Intronic
1089838641 11:121394139-121394161 CTCCCTTCCATGGTGGGGCAGGG + Intergenic
1090191922 11:124777235-124777257 CACCCTTCCAAGGCCATAAATGG + Intronic
1090413046 11:126522032-126522054 GACCCTTACATGGCCGGGCATGG - Intronic
1091135983 11:133189962-133189984 CATCCTTCCCTGGCGGGACCTGG + Intronic
1095364429 12:41385599-41385621 CACCCTTCCAAGACTGAACAAGG + Intronic
1096166087 12:49425608-49425630 AACACTTACATGGCCGGACGTGG - Intronic
1096646643 12:53041709-53041731 CACCCCTGCATGGCTGAACAGGG - Exonic
1097750953 12:63352126-63352148 CACCATTCCATAGCCATACATGG + Intergenic
1102712247 12:114938583-114938605 CGCCCTTCCTTGTCCGGCCAGGG + Intergenic
1104273998 12:127308292-127308314 CATTCCTCAATGGCCGGACAAGG - Intergenic
1104300796 12:127563218-127563240 CACCCTTCCCTGACCCTACATGG - Intergenic
1104875064 12:132028126-132028148 TACCCTTCCATGGCTAGGCAGGG - Exonic
1109105667 13:58247132-58247154 CAGCCAGCCATGGCCGAACATGG - Intergenic
1117118700 14:52545771-52545793 CACTCTTCCATGGTCCTACAAGG - Intronic
1118487385 14:66226692-66226714 CATCCTTACATGGCTGGAGAAGG + Intergenic
1119762450 14:77161134-77161156 CACCCTTACCTGGCCGAACAGGG + Intronic
1124704726 15:31954248-31954270 CTCCCTCCCTTGGCAGGACAGGG - Intergenic
1132244774 15:100285996-100286018 CAGCCTTCAATGCCCGAACAGGG + Intronic
1132600617 16:771003-771025 CACCCTTCCAACGCTGGGCATGG + Intronic
1132635633 16:944643-944665 CACTCTGCCATGGACGGGCATGG + Intronic
1133279471 16:4657065-4657087 CACCCTTCCAGGGCCTTCCACGG - Intronic
1134450621 16:14361104-14361126 CACCCTTCCAGGGCCAGGCACGG + Intergenic
1134602698 16:15545936-15545958 CAGCCTTCCATGGCCAGGAATGG + Intronic
1136487642 16:30583533-30583555 CTGCCTTCCAAGGCAGGACATGG - Intronic
1138659665 16:58509669-58509691 CAGGCTTCCCTGGCAGGACACGG - Intronic
1138897249 16:61221791-61221813 CACCCATACATGGCCGGGCACGG - Intergenic
1141058985 16:80846798-80846820 CACCCTCACATGGCAGGAGAAGG + Intergenic
1141586914 16:85040122-85040144 AACCCTTCTCTGGCCGGGCACGG - Intronic
1142194770 16:88734318-88734340 CACCTCTCCAGGGCCGGACAGGG + Intronic
1142292077 16:89197807-89197829 CACCAGTCCATGGCCGGCCTCGG + Intronic
1142691907 17:1611700-1611722 AACCCTTCAATGGCACGACAAGG + Intronic
1143219148 17:5247017-5247039 AACCCTTGCCTGGCCGGGCATGG + Intergenic
1149598545 17:57878357-57878379 CACCCTTCCAATGCCAGAAACGG - Intronic
1149658810 17:58324108-58324130 CTCCCTTCCAGGGCCAGCCAGGG + Intronic
1152248321 17:79197919-79197941 CCCCCTTCCATGCCCGGAGTCGG - Intronic
1161224561 19:3137026-3137048 CTCCCTGCCATGGCTGGAGAGGG + Intronic
1161889418 19:7023747-7023769 CACCCTGCCCTGGCAGGACTTGG - Intergenic
1161892034 19:7047000-7047022 CACCCTGCCCTGGCAGGACTTGG + Intergenic
1163727239 19:18929628-18929650 CACCCTTTCCTGGCAGGACCTGG - Exonic
1163897581 19:20073078-20073100 CACCCATCCATGCAAGGACAAGG + Intergenic
1165544727 19:36525494-36525516 CACATTTCAATGGCCGGGCATGG + Intronic
1167973105 19:53201245-53201267 CACCCATACATGGATGGACACGG + Intergenic
1168358440 19:55717669-55717691 CACGCTTCTGTGGCCGGAGACGG + Intronic
1168380420 19:55915779-55915801 CACCCCTCCATGGCTGATCATGG + Intronic
1168612370 19:57811560-57811582 CACCCTTCATTAGCCGGGCATGG + Intronic
927505735 2:23613473-23613495 AACCCATCCTTGGCCGGGCACGG + Intronic
929393735 2:41498817-41498839 CATCCATTCATGGCCGGGCATGG - Intergenic
929460108 2:42097110-42097132 CACCCTTCCATAGCCTGTCCAGG + Intergenic
929781248 2:44958502-44958524 CAGCCTTCCCTGGAGGGACAAGG - Intergenic
932493828 2:72137006-72137028 CAGGCCTCCATGGCGGGACAGGG + Intronic
932778475 2:74544011-74544033 AACACTTCAATGGCCGGGCACGG + Intronic
934574387 2:95391044-95391066 CTCCCTTCCAGGGCCACACAGGG - Intergenic
935639747 2:105279549-105279571 CTGCCTTCCTTGGCTGGACATGG - Intronic
945939025 2:215929971-215929993 CACCCTTCTCTGGTCGCACAAGG + Intergenic
947839825 2:233200575-233200597 CACCCTTCCCAGGCCTGACCTGG + Intronic
948057542 2:235019724-235019746 CACCCTTCCCTGGCCAGGCGTGG - Intronic
948908773 2:240992692-240992714 CCCCCTGCCATGGCCAGTCAGGG + Intronic
1168774779 20:438523-438545 CACCCTTCCATGGAAGGATTGGG - Exonic
1172022470 20:31924269-31924291 CACCCTTCCATGGCTTCCCATGG + Intronic
1174718028 20:52781123-52781145 CACCCTCCCAGGGCCTGAAATGG - Intergenic
1178514079 21:33230813-33230835 CACCCTCCCAGGGTCGGAGAGGG + Intronic
1180984853 22:19898220-19898242 CACCCATCCATGGCTGGCCCTGG + Intronic
1181011422 22:20043089-20043111 CACCATTCAATGGCGGGAGACGG - Intronic
1181168725 22:20996628-20996650 CACCCTCCCAGGGAAGGACAGGG - Intronic
1181549611 22:23629905-23629927 CTCCAATCCATGGCCGGGCACGG - Intronic
1181799015 22:25332069-25332091 CTCCAATCCATGGCCGGGCACGG + Intergenic
1181847830 22:25726847-25726869 CACCCTCCCATGGAGGCACAGGG + Exonic
1182278035 22:29202594-29202616 CACCCTCCCAGGGCAGGCCATGG - Intergenic
1182620556 22:31616298-31616320 GCCCCTTCCATCACCGGACAGGG - Intronic
1183134383 22:35872639-35872661 CACCCGTCAATGGCCTGCCAGGG + Intronic
1183465216 22:37976858-37976880 GGCCCATCCATGGCCAGACACGG + Intronic
1183837511 22:40468141-40468163 CATCCTTCCATGGTCTTACAGGG - Intronic
1184161724 22:42701086-42701108 CACCCTTGCCTGGTCAGACAGGG + Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1184246871 22:43240332-43240354 CACACTGCCATGGCAGGAGATGG - Intronic
949167282 3:958050-958072 CACCCCTGCATGGCTGAACAGGG + Intergenic
950636990 3:14322522-14322544 CACTCTTCCATGGCCAGGGAGGG + Intergenic
954594155 3:51811047-51811069 CATTCCTCCATGGCTGGACATGG + Intergenic
960708008 3:120499962-120499984 CACCCCTGCATGGCTGAACAGGG + Intergenic
961658608 3:128456785-128456807 AGCCCCTCCCTGGCCGGACAGGG - Intergenic
965570623 3:170168473-170168495 CACCACTCCACGGCCGGGCACGG + Intronic
968062789 3:195738963-195738985 CACCCTTCTCTAGCTGGACAGGG - Intronic
970554980 4:17222166-17222188 CACCCTTCCCTAGCTGTACATGG + Intergenic
971332397 4:25692986-25693008 AACCCTTCCAGGGCTGGGCATGG + Intergenic
972748428 4:41964298-41964320 CACACTTCAATGGCTGGGCACGG - Intergenic
981476512 4:145192401-145192423 CACCATCTCTTGGCCGGACACGG - Intergenic
981999030 4:151005154-151005176 CACCCTGTAATGGCCGGGCACGG + Intronic
986073790 5:4313548-4313570 CACCCTTCCATGGCAGCACGTGG + Intergenic
995695111 5:114870175-114870197 CACCCTTCCAAGACTGAACAAGG + Intergenic
997965010 5:138349869-138349891 CATCCTGCCATGGCCGGCAAAGG - Intergenic
1002162133 5:177320627-177320649 AGTCCTTCCATGGCCGGGCATGG + Intergenic
1002571375 5:180141202-180141224 GACCTTTCCATGGCAGGGCAGGG + Intronic
1005934129 6:30507002-30507024 AACCCTGCCTTGGCCGGGCACGG - Intergenic
1011712994 6:90073652-90073674 CACCCTGACATGAGCGGACAAGG + Intronic
1012903912 6:105041878-105041900 CACCCTCCCATGCCAGGCCAAGG - Intronic
1013731529 6:113173812-113173834 CACCCCTGCATGGCTGAACAGGG + Intergenic
1019021713 6:168924093-168924115 CACCCTGTCTTGGCCGGGCATGG - Intergenic
1022414569 7:30167036-30167058 CACTCTCCCATGGCAGGACCTGG - Intergenic
1022632150 7:32095364-32095386 CACCCTTCCATGGCCGGACATGG + Intronic
1023141993 7:37110865-37110887 CACCCTTGCATGGCTGGGTATGG + Intronic
1024000266 7:45184962-45184984 CAACCTTTCATGCCCGGCCAAGG - Intronic
1029545266 7:101207264-101207286 CACCCTGCGATGGCCGGGCGTGG - Intronic
1029595389 7:101535085-101535107 AGCCCTTCCATGGGCGGGCAGGG + Intronic
1029959166 7:104671072-104671094 CACCCCTGCATGGCTGAACAGGG - Intronic
1032209685 7:129902206-129902228 AACCATTACATGGCCGGGCACGG + Intronic
1035124476 7:156597694-156597716 CACCCCTCCATTGCCAGTCATGG - Intergenic
1039885285 8:41650725-41650747 CTCCTTGCCCTGGCCGGACAGGG + Intergenic
1051171535 9:14322588-14322610 CACCCTACCACGGCCGGCCTGGG + Intronic
1056792233 9:89633386-89633408 CACCCCTCCATGACATGACACGG + Intergenic
1056944113 9:90979131-90979153 CACCCATTCATGGCAGGGCAGGG + Intergenic
1058856535 9:109068075-109068097 AAGCCTTCCTTGGCCGGACGCGG + Intronic
1059953170 9:119488986-119489008 CACCCTTTCATGGGTAGACATGG - Intergenic
1062495923 9:136831653-136831675 CACCTTTCCAGGGAGGGACAGGG + Intronic
1191904326 X:66072986-66073008 CACCCCTGCATGGCTGAACAGGG + Intergenic
1193294233 X:79815669-79815691 CACCCTTCCAAGGCAGGGCCGGG - Intergenic
1193957589 X:87881593-87881615 CACCCTTCCAGGGCTGGGCACGG + Intergenic
1196807298 X:119599783-119599805 AACCCCTACATGGCCAGACACGG - Intronic
1197558995 X:127993529-127993551 AACTCTTCCATGCCCAGACATGG + Intergenic
1197952068 X:131908294-131908316 CAGCCTGCCATGGCCGCCCATGG + Intergenic