ID: 1022632163

View in Genome Browser
Species Human (GRCh38)
Location 7:32095450-32095472
Sequence GCAGCCTTCCTTGCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022632160_1022632163 18 Left 1022632160 7:32095409-32095431 CCTTCCTTCCAGACAATGGCATT 0: 1
1: 0
2: 2
3: 25
4: 336
Right 1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG No data
1022632162_1022632163 10 Left 1022632162 7:32095417-32095439 CCAGACAATGGCATTTGAGATGT 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG No data
1022632159_1022632163 19 Left 1022632159 7:32095408-32095430 CCCTTCCTTCCAGACAATGGCAT 0: 1
1: 0
2: 2
3: 25
4: 358
Right 1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG No data
1022632161_1022632163 14 Left 1022632161 7:32095413-32095435 CCTTCCAGACAATGGCATTTGAG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG No data
1022632157_1022632163 26 Left 1022632157 7:32095401-32095423 CCTCAGTCCCTTCCTTCCAGACA 0: 1
1: 1
2: 2
3: 50
4: 505
Right 1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022632163 Original CRISPR GCAGCCTTCCTTGCTAAAAC TGG Intronic
No off target data available for this crispr