ID: 1022632402

View in Genome Browser
Species Human (GRCh38)
Location 7:32097706-32097728
Sequence CAGTGTTGGCTGAGGCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022632402_1022632408 15 Left 1022632402 7:32097706-32097728 CCAGCTAGCCTCAGCCAACACTG 0: 1
1: 1
2: 2
3: 8
4: 146
Right 1022632408 7:32097744-32097766 TGAGACTCACACTGGGAAATGGG No data
1022632402_1022632405 7 Left 1022632402 7:32097706-32097728 CCAGCTAGCCTCAGCCAACACTG 0: 1
1: 1
2: 2
3: 8
4: 146
Right 1022632405 7:32097736-32097758 TGTGTAACTGAGACTCACACTGG 0: 1
1: 0
2: 0
3: 20
4: 162
1022632402_1022632409 19 Left 1022632402 7:32097706-32097728 CCAGCTAGCCTCAGCCAACACTG 0: 1
1: 1
2: 2
3: 8
4: 146
Right 1022632409 7:32097748-32097770 ACTCACACTGGGAAATGGGTAGG No data
1022632402_1022632407 14 Left 1022632402 7:32097706-32097728 CCAGCTAGCCTCAGCCAACACTG 0: 1
1: 1
2: 2
3: 8
4: 146
Right 1022632407 7:32097743-32097765 CTGAGACTCACACTGGGAAATGG 0: 1
1: 0
2: 0
3: 38
4: 286
1022632402_1022632406 8 Left 1022632402 7:32097706-32097728 CCAGCTAGCCTCAGCCAACACTG 0: 1
1: 1
2: 2
3: 8
4: 146
Right 1022632406 7:32097737-32097759 GTGTAACTGAGACTCACACTGGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022632402 Original CRISPR CAGTGTTGGCTGAGGCTAGC TGG (reversed) Intronic
900326958 1:2113062-2113084 CACTGCTGGCCGAGGCTGGCCGG + Intronic
900569633 1:3351917-3351939 CACTGATGCCTGAGGGTAGCTGG + Intronic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
907000176 1:50845000-50845022 CAGTGTTGACTTAAGTTAGCTGG - Intronic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
910248058 1:85163761-85163783 CAGTGTGGGGTGAGAGTAGCAGG + Intronic
913478729 1:119264061-119264083 CAGTTTTGGCTGAGGGTGGGGGG - Intergenic
913478767 1:119264435-119264457 CAGTTTTGGCTGAGGGTGGGGGG + Intergenic
914246949 1:145893317-145893339 TAATGTGGGGTGAGGCTAGCTGG - Intronic
916070887 1:161169123-161169145 CAGTGTTCTCAGAGGCCAGCCGG + Exonic
916073076 1:161183067-161183089 CAGTGTAGGCTGAGGGGAGTTGG - Intergenic
916474255 1:165153570-165153592 CTGTCTTGGCTCAGGCAAGCAGG + Intergenic
1063613236 10:7580772-7580794 CAGTGTTGTCTAGGGCTAGGTGG + Intronic
1065635064 10:27723558-27723580 CTGTGATGCCTGAGCCTAGCAGG - Intronic
1066785300 10:38997001-38997023 CATTGTTGGATGAGGCCGGCTGG - Intergenic
1071528298 10:86371225-86371247 CCCTGGTGGCTGAGGCAAGCTGG - Intergenic
1074775838 10:116767518-116767540 CCTTGCTGGCTGAGGCTAGTGGG - Intergenic
1075823806 10:125336556-125336578 CAGTGCTGGCTGAGGCTCTGTGG - Intergenic
1075982104 10:126748980-126749002 CAGTGATGGATGAGGATCGCTGG - Intergenic
1077318960 11:1932374-1932396 CAGGGTTGGCAGGGGCCAGCGGG + Intronic
1081755441 11:45541002-45541024 GAATGTGGGCTGAGGCCAGCTGG - Intergenic
1081935381 11:46900237-46900259 GAGTGTTGGCAGAGGCTGGGCGG - Intronic
1083640911 11:64144790-64144812 ATGTGTTTGCTGAGGCTTGCCGG - Intronic
1084066115 11:66705268-66705290 CCGTGTCGGCTGAGGCCAGGAGG + Exonic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1085158909 11:74322963-74322985 CAGTTTTGACTGAGGTCAGCTGG - Intergenic
1085990749 11:81840445-81840467 CATTGTTGGCTGATCTTAGCTGG + Intergenic
1086799458 11:91153225-91153247 CAGTGATGGTTGAGGGTATCTGG - Intergenic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1088589738 11:111393128-111393150 CACTGTGGGCTGATGCTATCTGG + Intronic
1089172640 11:116526104-116526126 CAGACTGGGCTGAGGCTTGCTGG - Intergenic
1089614701 11:119688662-119688684 CAGGGCTGGCTGTGGCAAGCTGG + Intronic
1092009132 12:5094942-5094964 CACTGTAGGCTGAGGCTCTCGGG + Intergenic
1097167765 12:57094693-57094715 AAGTGGAGGCTGAGGCCAGCCGG + Exonic
1097664861 12:62466965-62466987 CAGAGTCGGCGGAGCCTAGCGGG + Exonic
1101937424 12:109069653-109069675 CAGTGGGGGATGAGGATAGCAGG + Intronic
1107003913 13:35585147-35585169 CAGAGTGGGCGGAGGCTGGCAGG - Intronic
1111347883 13:86986222-86986244 CAGTGTTGGCTTAGGCGATGGGG - Intergenic
1113435079 13:110285048-110285070 CAGTCTGGGCTGAGGCTTTCAGG + Intronic
1113559503 13:111266900-111266922 CAGTGTTGGGTGTGCCTAACGGG - Intronic
1114424867 14:22613026-22613048 CTGTGCTGGCTGAGTCCAGCTGG + Exonic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1118012220 14:61621621-61621643 CAGTGCTGGTTGGGGCTGGCTGG + Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1119646292 14:76350888-76350910 CAGTGCTGAGTGAGGCTGGCAGG + Intronic
1121948110 14:98142525-98142547 CAGTGATCACTGAGTCTAGCTGG + Intergenic
1122649431 14:103217758-103217780 GAGTGTTGGCTGGGCTTAGCTGG - Intergenic
1123123116 14:105927198-105927220 CAGTGCTGGCTGAGGACAGGCGG - Intronic
1128677662 15:69623802-69623824 CAGTGCTGGGGGAGGCTAGGAGG - Intergenic
1128717564 15:69919845-69919867 CAGTGCTGCCTGTGGCTACCAGG + Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1131440622 15:92456866-92456888 GAGTGTTGGCTTAGGCAGGCAGG + Intronic
1133305461 16:4805383-4805405 CAGTGGTGGATGTGGCCAGCAGG + Intronic
1140754423 16:78054945-78054967 CAGTTTTGCCTCAGACTAGCTGG + Intronic
1143732947 17:8891335-8891357 CAGTGTGGTCTGGGGCGAGCGGG + Intronic
1146102661 17:29999586-29999608 CTGTGTTGGTTTATGCTAGCAGG - Intronic
1146107934 17:30059610-30059632 CAGTGATGGCTCAGGCTTCCTGG + Exonic
1148991863 17:51673165-51673187 CAGGGCTGGCTGGGGCTAGGGGG - Intronic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1152188574 17:78874317-78874339 CACTGGTGGCTGGGGCAAGCAGG + Intronic
1158391269 18:57047065-57047087 CAGGGCTGGCTGAGGCTCTCGGG + Intergenic
1162004541 19:7768996-7769018 CAATGGAGGCTGAGGCTAGCAGG - Exonic
1162791964 19:13067718-13067740 CAGTGTTGGCTGTAGCCAGCAGG + Intronic
1162936426 19:13983772-13983794 CAGAGCGGGCTGAGGCTTGCAGG + Intronic
1163236446 19:16033015-16033037 CAGTGTTGGATGTGGTTAGCGGG + Intergenic
1163292813 19:16391762-16391784 CAGAGTTGGCTGATGCTCTCAGG + Intronic
1164159140 19:22615386-22615408 CAGAGTGGCTTGAGGCTAGCTGG + Intergenic
1164843896 19:31415789-31415811 CAGTATTGGGTAAGGCTGGCAGG - Intergenic
1165941686 19:39417700-39417722 CAGGGTGGGCTGGGGCTTGCTGG + Intronic
1168630125 19:57949902-57949924 CAGTGCTGGCTGAGGGCAGGAGG + Intergenic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
926455085 2:13057112-13057134 CCGTGTGAGGTGAGGCTAGCTGG + Intergenic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
927516705 2:23675789-23675811 CAGTGTTGCCTGAAGTTAGAGGG + Intronic
929236966 2:39615795-39615817 TAGTGTTGGCAGAGGCTGGGAGG + Intergenic
932683660 2:73849424-73849446 CAGTGTTGGCACTGGCTAACTGG - Exonic
934994358 2:98943412-98943434 TAGTGTTGGCCGAGGCTGGGAGG + Intergenic
938972911 2:136448623-136448645 CAGTGGAGGCTGAGCCCAGCAGG + Intergenic
941589484 2:167401763-167401785 CGGTTTTGGCTGAGGCTTGAAGG - Intergenic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
946689805 2:222301537-222301559 CAAAGTTGGCTGAGGCTGCCTGG + Intronic
947083132 2:226420919-226420941 CAGAGTTGGCTGAAGTTGGCTGG + Intergenic
947289391 2:228555268-228555290 CTGTGTTGGCTGTGGCTGACAGG + Intergenic
1168897122 20:1331285-1331307 CAGTGGTGGATGTGGCTAGGTGG - Intronic
1169970861 20:11268167-11268189 CAGGGTTGGCTGATTTTAGCTGG - Intergenic
1172620887 20:36317867-36317889 CAGGGCTGGCTGAGGTTGGCAGG + Intronic
1172625500 20:36344407-36344429 CAGTGATGGCTGATGCTTACTGG + Intronic
1172952428 20:38730623-38730645 CAGTGATGGCTGAGGACACCGGG - Intergenic
1175333084 20:58177954-58177976 TAGTGGTGGCTGAGGCTCGGCGG - Intergenic
1175610103 20:60343872-60343894 CACTGTGGACTAAGGCTAGCTGG - Intergenic
1175982013 20:62743412-62743434 CAGTGTTTGCTGGGTCTAGTGGG + Intronic
1179406954 21:41134342-41134364 TAGTGTTGAGTGAGGATAGCTGG - Intergenic
1180605464 22:17055911-17055933 CAGGTTTGGCTGAAGCAAGCAGG + Intergenic
1182038528 22:27218394-27218416 CCGTGTTGGCTGTTGCTAGTAGG + Intergenic
1183467412 22:37986675-37986697 CAGTGTTGGGTGAGGCAGGTGGG + Intronic
1184301073 22:43561437-43561459 CAGTGGTGGCTGAGGGGGGCGGG - Intronic
952307292 3:32157491-32157513 CAGTGATTGCAGGGGCTAGCGGG - Intronic
952810769 3:37400594-37400616 CTGTTTTGGCTGAGGCTGGCTGG + Intronic
953551380 3:43906420-43906442 CAGCCTTGGCTGATGCCAGCAGG - Intergenic
954223932 3:49171079-49171101 CAGTGTACACTGAGGCTAGCGGG - Intergenic
960996767 3:123345311-123345333 CTGTGTTGGCCGAGGCAGGCTGG + Intronic
963847902 3:150178627-150178649 TGGGGTTGGCTGAGGCTATCAGG - Intergenic
966125183 3:176568174-176568196 AATTTTTGGCTGAAGCTAGCAGG + Intergenic
967191874 3:186991692-186991714 CAGTATGGGATGAGGCCAGCCGG - Intronic
979790953 4:124780682-124780704 TAGTGTTGGCTGAGAGAAGCGGG - Intergenic
981334482 4:143554964-143554986 CAGTGGTGGCAGGGCCTAGCTGG - Exonic
985012097 4:185593189-185593211 CAGTGTGGGCAGAGGCCAACAGG + Intronic
985800636 5:2003538-2003560 CAGTGTAGGGTGAGGCTGGGAGG + Intergenic
987552167 5:19397105-19397127 CAGTGGTTGCAGAGACTAGCAGG + Intergenic
988149228 5:27354280-27354302 CAGTGGCTGCTGAGGCTAGAAGG + Intergenic
994168762 5:96636739-96636761 CAGTGGTGGCTGTGGCTGGTGGG + Intronic
996570624 5:124929363-124929385 CAGTGCTGGCTGAGGCTGTGTGG + Intergenic
1002084326 5:176762550-176762572 TAGTGTTGGGGGAGGCTAGGGGG - Intergenic
1004275415 6:14231403-14231425 CAGTGTTGGGTCAAGCTTGCTGG + Intergenic
1005722851 6:28619935-28619957 TAGTGTTAGCTGAGGCTGTCAGG - Intergenic
1006204268 6:32326267-32326289 CAGTGGTGGCAGGGCCTAGCTGG + Intronic
1006459676 6:34151073-34151095 CAGGGATGGCTGAGGCTGGGAGG + Intronic
1007737038 6:43988141-43988163 CTGTTTTGGCTGAGGCAGGCTGG + Intergenic
1011149158 6:84249943-84249965 CAGTGTTGGCAGGGACTAACAGG + Intergenic
1015116425 6:129654625-129654647 CAGCGTTGGCTGTAGCTAGCGGG - Intronic
1020440140 7:8208783-8208805 CAGTGTTGGGTGGGGGTAGGGGG + Intronic
1022632402 7:32097706-32097728 CAGTGTTGGCTGAGGCTAGCTGG - Intronic
1024803367 7:53107308-53107330 CAATGATGGCTGAAGCTAACTGG + Intergenic
1030673910 7:112365241-112365263 CAGTGTTGGCTGAGGCTTGCAGG + Intergenic
1032109867 7:129066784-129066806 CAGTGTTGGCTGAATCTTGGTGG + Intergenic
1033685116 7:143632635-143632657 TATTGTTGGCTGAGGCTGGAAGG - Intronic
1033688289 7:143711854-143711876 TATTGTTGGCTGAGGCTGGAAGG - Intronic
1033699498 7:143824986-143825008 TATTGTTGGCTGAGGCTGGAAGG + Intergenic
1034459544 7:151190963-151190985 AAGTGATGGCTAAGGCTTGCGGG - Exonic
1034532491 7:151705234-151705256 CAGAGTTGGCTGAGAATATCAGG + Intronic
1036286636 8:7448819-7448841 GAGTGTTTGCTGAGGCTTCCGGG - Intronic
1036334841 8:7862705-7862727 GAGTGTTTGCTGAGGCTTCCGGG + Intronic
1039547055 8:38417925-38417947 TGGTGTTGGCAGAGGCTATCGGG - Exonic
1040103117 8:43522300-43522322 CAGTGTTGGTTGAGGGTGGGGGG + Intergenic
1040779147 8:51086395-51086417 CAGTGTTCACAGAGGCTAGTGGG - Intergenic
1045573493 8:103394028-103394050 CAGTGTTGTCTGTGGTTAGATGG + Intergenic
1046197961 8:110887547-110887569 CAATGTTGGATGGGGGTAGCTGG + Intergenic
1048377856 8:133838199-133838221 CAGGGTCGGCAGAGCCTAGCCGG - Intergenic
1049573155 8:143378886-143378908 CAGTGTTGGGTCAGGCTGGGTGG - Intronic
1049612392 8:143561627-143561649 CAGTGTTGGCAGTGGTGAGCGGG + Intronic
1049744689 8:144258305-144258327 CAGTGTCGGCTGAGGCTGGCTGG - Intronic
1051604662 9:18907830-18907852 CAGTGTTGGCACAGACTAGATGG - Intronic
1052956862 9:34259236-34259258 CAATTTGGGCTGAGGCCAGCAGG + Intronic
1053139436 9:35673621-35673643 CAGGGTTAGCTGAGGCTGGCTGG + Intronic
1053456309 9:38235522-38235544 CCGTGTGAGCTGTGGCTAGCAGG + Intergenic
1055978125 9:81974147-81974169 AACTGTTGGCTGGAGCTAGCTGG + Intergenic
1056306993 9:85300193-85300215 GAGTGTGGGCTGAGGGTAGGAGG + Intergenic
1056479382 9:86985530-86985552 CAGTGGTGGCTGTGGGTGGCTGG - Intergenic
1058543943 9:106041060-106041082 CAGTGTTGGCTGGGGTTAGCTGG - Intergenic
1059556843 9:115289895-115289917 CAGTGTGGGCTGTGGCTGACAGG - Intronic
1061134915 9:128728368-128728390 CAGTGTTGGCTGCTGCTGGCAGG + Intergenic
1062081611 9:134626992-134627014 CACTGTTGGCTGCAGCAAGCCGG + Intergenic
1189223867 X:39396459-39396481 CAGGGCAGGCTGAGGCTACCTGG - Intergenic
1192204012 X:69084246-69084268 CAGAGTTGGCCGAGGGTAGGAGG + Intergenic
1197592901 X:128430391-128430413 CACTGAGGGCTGAGGCTAGTAGG - Intergenic
1197729759 X:129799424-129799446 GAGTCTTGGCTGAGTCTAGAGGG - Intergenic
1201935948 Y:19411238-19411260 CATTGTTGACTGTGGCTGGCTGG - Intergenic