ID: 1022634495

View in Genome Browser
Species Human (GRCh38)
Location 7:32119293-32119315
Sequence TTAAGACCTTGGCGTAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022634495_1022634501 16 Left 1022634495 7:32119293-32119315 CCCAGGTTACGCCAAGGTCTTAA 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG No data
1022634495_1022634504 30 Left 1022634495 7:32119293-32119315 CCCAGGTTACGCCAAGGTCTTAA 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1022634504 7:32119346-32119368 TCCTGTTGGTAGCTGCCAAAGGG No data
1022634495_1022634503 29 Left 1022634495 7:32119293-32119315 CCCAGGTTACGCCAAGGTCTTAA 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1022634503 7:32119345-32119367 CTCCTGTTGGTAGCTGCCAAAGG No data
1022634495_1022634499 6 Left 1022634495 7:32119293-32119315 CCCAGGTTACGCCAAGGTCTTAA 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1022634499 7:32119322-32119344 CTCCAGGCTTGCCTCACTTCAGG 0: 1
1: 0
2: 2
3: 26
4: 224
1022634495_1022634498 -10 Left 1022634495 7:32119293-32119315 CCCAGGTTACGCCAAGGTCTTAA 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1022634498 7:32119306-32119328 AAGGTCTTAACTACAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022634495 Original CRISPR TTAAGACCTTGGCGTAACCT GGG (reversed) Intronic