ID: 1022634496

View in Genome Browser
Species Human (GRCh38)
Location 7:32119294-32119316
Sequence GTTAAGACCTTGGCGTAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022634496_1022634504 29 Left 1022634496 7:32119294-32119316 CCAGGTTACGCCAAGGTCTTAAC No data
Right 1022634504 7:32119346-32119368 TCCTGTTGGTAGCTGCCAAAGGG No data
1022634496_1022634503 28 Left 1022634496 7:32119294-32119316 CCAGGTTACGCCAAGGTCTTAAC No data
Right 1022634503 7:32119345-32119367 CTCCTGTTGGTAGCTGCCAAAGG No data
1022634496_1022634506 30 Left 1022634496 7:32119294-32119316 CCAGGTTACGCCAAGGTCTTAAC No data
Right 1022634506 7:32119347-32119369 CCTGTTGGTAGCTGCCAAAGGGG No data
1022634496_1022634501 15 Left 1022634496 7:32119294-32119316 CCAGGTTACGCCAAGGTCTTAAC No data
Right 1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG No data
1022634496_1022634499 5 Left 1022634496 7:32119294-32119316 CCAGGTTACGCCAAGGTCTTAAC No data
Right 1022634499 7:32119322-32119344 CTCCAGGCTTGCCTCACTTCAGG 0: 1
1: 0
2: 2
3: 26
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022634496 Original CRISPR GTTAAGACCTTGGCGTAACC TGG (reversed) Intronic