ID: 1022634497

View in Genome Browser
Species Human (GRCh38)
Location 7:32119304-32119326
Sequence TGGAGTTGTAGTTAAGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022634497_1022634499 -5 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634499 7:32119322-32119344 CTCCAGGCTTGCCTCACTTCAGG 0: 1
1: 0
2: 2
3: 26
4: 224
1022634497_1022634503 18 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634503 7:32119345-32119367 CTCCTGTTGGTAGCTGCCAAAGG No data
1022634497_1022634506 20 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634506 7:32119347-32119369 CCTGTTGGTAGCTGCCAAAGGGG No data
1022634497_1022634501 5 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG No data
1022634497_1022634504 19 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634504 7:32119346-32119368 TCCTGTTGGTAGCTGCCAAAGGG No data
1022634497_1022634507 27 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634507 7:32119354-32119376 GTAGCTGCCAAAGGGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022634497 Original CRISPR TGGAGTTGTAGTTAAGACCT TGG (reversed) Intronic