ID: 1022634499

View in Genome Browser
Species Human (GRCh38)
Location 7:32119322-32119344
Sequence CTCCAGGCTTGCCTCACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022634494_1022634499 7 Left 1022634494 7:32119292-32119314 CCCCAGGTTACGCCAAGGTCTTA 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1022634499 7:32119322-32119344 CTCCAGGCTTGCCTCACTTCAGG 0: 1
1: 0
2: 2
3: 26
4: 224
1022634497_1022634499 -5 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634499 7:32119322-32119344 CTCCAGGCTTGCCTCACTTCAGG 0: 1
1: 0
2: 2
3: 26
4: 224
1022634491_1022634499 29 Left 1022634491 7:32119270-32119292 CCTACAAAATGACATTGAAAAGC 0: 1
1: 0
2: 1
3: 31
4: 334
Right 1022634499 7:32119322-32119344 CTCCAGGCTTGCCTCACTTCAGG 0: 1
1: 0
2: 2
3: 26
4: 224
1022634495_1022634499 6 Left 1022634495 7:32119293-32119315 CCCAGGTTACGCCAAGGTCTTAA 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1022634499 7:32119322-32119344 CTCCAGGCTTGCCTCACTTCAGG 0: 1
1: 0
2: 2
3: 26
4: 224
1022634496_1022634499 5 Left 1022634496 7:32119294-32119316 CCAGGTTACGCCAAGGTCTTAAC No data
Right 1022634499 7:32119322-32119344 CTCCAGGCTTGCCTCACTTCAGG 0: 1
1: 0
2: 2
3: 26
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022634499 Original CRISPR CTCCAGGCTTGCCTCACTTC AGG Intronic