ID: 1022634500

View in Genome Browser
Species Human (GRCh38)
Location 7:32119324-32119346
Sequence AGCCTGAAGTGAGGCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 294}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022634500_1022634504 -1 Left 1022634500 7:32119324-32119346 CCAGGCTTGCCTCACTTCAGGCT 0: 1
1: 0
2: 4
3: 27
4: 294
Right 1022634504 7:32119346-32119368 TCCTGTTGGTAGCTGCCAAAGGG No data
1022634500_1022634503 -2 Left 1022634500 7:32119324-32119346 CCAGGCTTGCCTCACTTCAGGCT 0: 1
1: 0
2: 4
3: 27
4: 294
Right 1022634503 7:32119345-32119367 CTCCTGTTGGTAGCTGCCAAAGG No data
1022634500_1022634510 26 Left 1022634500 7:32119324-32119346 CCAGGCTTGCCTCACTTCAGGCT 0: 1
1: 0
2: 4
3: 27
4: 294
Right 1022634510 7:32119373-32119395 CAGGAAAGCAACAGCTTCATGGG 0: 1
1: 0
2: 2
3: 17
4: 190
1022634500_1022634509 25 Left 1022634500 7:32119324-32119346 CCAGGCTTGCCTCACTTCAGGCT 0: 1
1: 0
2: 4
3: 27
4: 294
Right 1022634509 7:32119372-32119394 TCAGGAAAGCAACAGCTTCATGG No data
1022634500_1022634506 0 Left 1022634500 7:32119324-32119346 CCAGGCTTGCCTCACTTCAGGCT 0: 1
1: 0
2: 4
3: 27
4: 294
Right 1022634506 7:32119347-32119369 CCTGTTGGTAGCTGCCAAAGGGG No data
1022634500_1022634507 7 Left 1022634500 7:32119324-32119346 CCAGGCTTGCCTCACTTCAGGCT 0: 1
1: 0
2: 4
3: 27
4: 294
Right 1022634507 7:32119354-32119376 GTAGCTGCCAAAGGGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022634500 Original CRISPR AGCCTGAAGTGAGGCAAGCC TGG (reversed) Intronic