ID: 1022634501

View in Genome Browser
Species Human (GRCh38)
Location 7:32119332-32119354
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022634497_1022634501 5 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG No data
1022634495_1022634501 16 Left 1022634495 7:32119293-32119315 CCCAGGTTACGCCAAGGTCTTAA 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG No data
1022634496_1022634501 15 Left 1022634496 7:32119294-32119316 CCAGGTTACGCCAAGGTCTTAAC No data
Right 1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG No data
1022634494_1022634501 17 Left 1022634494 7:32119292-32119314 CCCCAGGTTACGCCAAGGTCTTA 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type