ID: 1022634502

View in Genome Browser
Species Human (GRCh38)
Location 7:32119333-32119355
Sequence ACCAACAGGAGCCTGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022634502_1022634509 16 Left 1022634502 7:32119333-32119355 CCTCACTTCAGGCTCCTGTTGGT 0: 1
1: 0
2: 2
3: 15
4: 202
Right 1022634509 7:32119372-32119394 TCAGGAAAGCAACAGCTTCATGG No data
1022634502_1022634510 17 Left 1022634502 7:32119333-32119355 CCTCACTTCAGGCTCCTGTTGGT 0: 1
1: 0
2: 2
3: 15
4: 202
Right 1022634510 7:32119373-32119395 CAGGAAAGCAACAGCTTCATGGG 0: 1
1: 0
2: 2
3: 17
4: 190
1022634502_1022634504 -10 Left 1022634502 7:32119333-32119355 CCTCACTTCAGGCTCCTGTTGGT 0: 1
1: 0
2: 2
3: 15
4: 202
Right 1022634504 7:32119346-32119368 TCCTGTTGGTAGCTGCCAAAGGG No data
1022634502_1022634507 -2 Left 1022634502 7:32119333-32119355 CCTCACTTCAGGCTCCTGTTGGT 0: 1
1: 0
2: 2
3: 15
4: 202
Right 1022634507 7:32119354-32119376 GTAGCTGCCAAAGGGGTCTCAGG No data
1022634502_1022634506 -9 Left 1022634502 7:32119333-32119355 CCTCACTTCAGGCTCCTGTTGGT 0: 1
1: 0
2: 2
3: 15
4: 202
Right 1022634506 7:32119347-32119369 CCTGTTGGTAGCTGCCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022634502 Original CRISPR ACCAACAGGAGCCTGAAGTG AGG (reversed) Intronic