ID: 1022634503

View in Genome Browser
Species Human (GRCh38)
Location 7:32119345-32119367
Sequence CTCCTGTTGGTAGCTGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022634497_1022634503 18 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634503 7:32119345-32119367 CTCCTGTTGGTAGCTGCCAAAGG No data
1022634500_1022634503 -2 Left 1022634500 7:32119324-32119346 CCAGGCTTGCCTCACTTCAGGCT 0: 1
1: 0
2: 4
3: 27
4: 294
Right 1022634503 7:32119345-32119367 CTCCTGTTGGTAGCTGCCAAAGG No data
1022634494_1022634503 30 Left 1022634494 7:32119292-32119314 CCCCAGGTTACGCCAAGGTCTTA 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1022634503 7:32119345-32119367 CTCCTGTTGGTAGCTGCCAAAGG No data
1022634495_1022634503 29 Left 1022634495 7:32119293-32119315 CCCAGGTTACGCCAAGGTCTTAA 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1022634503 7:32119345-32119367 CTCCTGTTGGTAGCTGCCAAAGG No data
1022634496_1022634503 28 Left 1022634496 7:32119294-32119316 CCAGGTTACGCCAAGGTCTTAAC No data
Right 1022634503 7:32119345-32119367 CTCCTGTTGGTAGCTGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022634503 Original CRISPR CTCCTGTTGGTAGCTGCCAA AGG Intronic