ID: 1022634506

View in Genome Browser
Species Human (GRCh38)
Location 7:32119347-32119369
Sequence CCTGTTGGTAGCTGCCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022634496_1022634506 30 Left 1022634496 7:32119294-32119316 CCAGGTTACGCCAAGGTCTTAAC No data
Right 1022634506 7:32119347-32119369 CCTGTTGGTAGCTGCCAAAGGGG No data
1022634497_1022634506 20 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634506 7:32119347-32119369 CCTGTTGGTAGCTGCCAAAGGGG No data
1022634502_1022634506 -9 Left 1022634502 7:32119333-32119355 CCTCACTTCAGGCTCCTGTTGGT 0: 1
1: 0
2: 2
3: 15
4: 202
Right 1022634506 7:32119347-32119369 CCTGTTGGTAGCTGCCAAAGGGG No data
1022634500_1022634506 0 Left 1022634500 7:32119324-32119346 CCAGGCTTGCCTCACTTCAGGCT 0: 1
1: 0
2: 4
3: 27
4: 294
Right 1022634506 7:32119347-32119369 CCTGTTGGTAGCTGCCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022634506 Original CRISPR CCTGTTGGTAGCTGCCAAAG GGG Intronic