ID: 1022634507

View in Genome Browser
Species Human (GRCh38)
Location 7:32119354-32119376
Sequence GTAGCTGCCAAAGGGGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022634502_1022634507 -2 Left 1022634502 7:32119333-32119355 CCTCACTTCAGGCTCCTGTTGGT 0: 1
1: 0
2: 2
3: 15
4: 202
Right 1022634507 7:32119354-32119376 GTAGCTGCCAAAGGGGTCTCAGG No data
1022634497_1022634507 27 Left 1022634497 7:32119304-32119326 CCAAGGTCTTAACTACAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1022634507 7:32119354-32119376 GTAGCTGCCAAAGGGGTCTCAGG No data
1022634500_1022634507 7 Left 1022634500 7:32119324-32119346 CCAGGCTTGCCTCACTTCAGGCT 0: 1
1: 0
2: 4
3: 27
4: 294
Right 1022634507 7:32119354-32119376 GTAGCTGCCAAAGGGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022634507 Original CRISPR GTAGCTGCCAAAGGGGTCTC AGG Intronic