ID: 1022637680

View in Genome Browser
Species Human (GRCh38)
Location 7:32152545-32152567
Sequence CCCCATGAAAAGGGCTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022637676_1022637680 5 Left 1022637676 7:32152517-32152539 CCAGGCTGATGGGAATTGCTGGA 0: 1
1: 0
2: 3
3: 19
4: 213
Right 1022637680 7:32152545-32152567 CCCCATGAAAAGGGCTACTCAGG No data
1022637668_1022637680 30 Left 1022637668 7:32152492-32152514 CCCAGTTGCATGAAACCTAAGGG 0: 1
1: 0
2: 1
3: 3
4: 80
Right 1022637680 7:32152545-32152567 CCCCATGAAAAGGGCTACTCAGG No data
1022637673_1022637680 15 Left 1022637673 7:32152507-32152529 CCTAAGGGTTCCAGGCTGATGGG 0: 1
1: 0
2: 1
3: 21
4: 311
Right 1022637680 7:32152545-32152567 CCCCATGAAAAGGGCTACTCAGG No data
1022637670_1022637680 29 Left 1022637670 7:32152493-32152515 CCAGTTGCATGAAACCTAAGGGT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1022637680 7:32152545-32152567 CCCCATGAAAAGGGCTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022637680 Original CRISPR CCCCATGAAAAGGGCTACTC AGG Intronic
No off target data available for this crispr