ID: 1022643957

View in Genome Browser
Species Human (GRCh38)
Location 7:32213621-32213643
Sequence AGGCAAGCAGCAGTGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 2, 2: 3, 3: 28, 4: 347}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022643957 Original CRISPR AGGCAAGCAGCAGTGTTTGA GGG (reversed) Intronic
903590469 1:24451977-24451999 ATGAAAGCAGCTGTGTTTTATGG + Intronic
904917677 1:33982142-33982164 AGGCAAACAGAAGTGGGTGATGG + Intronic
905500890 1:38435450-38435472 AGGATTGCAGTAGTGTTTGATGG + Intergenic
906478501 1:46185590-46185612 TGGCAAGCAGCAGTGATTGGGGG + Exonic
906532500 1:46531795-46531817 AGGGCAGCAGTAGTGGTTGAGGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908079698 1:60563022-60563044 AGGCAAGCAGCGGTGACTGCCGG - Intergenic
908821024 1:68086774-68086796 AGGAAAGCAACAGAGTTTGAGGG + Intergenic
909366881 1:74835117-74835139 AGGGAGGCAGCAGAGTCTGATGG - Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
913670166 1:121090165-121090187 ATTCAAGCAGAAGTGTTTCATGG + Intronic
914021932 1:143877607-143877629 ATTCAAGCAGAAGTGTTTCATGG + Intergenic
914660414 1:149785535-149785557 ATTCAAGCAGAAGTGTTTCATGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918115055 1:181488904-181488926 GGGAAAGCAGCAGAATTTGAGGG - Intronic
918433413 1:184485911-184485933 AGGGCAGGAGAAGTGTTTGACGG + Intronic
918837464 1:189486111-189486133 AGGAAAGGAGCAGTTTATGATGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919265471 1:195258626-195258648 AAGTCAGCTGCAGTGTTTGAGGG + Intergenic
920253886 1:204640904-204640926 AGGAAAACAGCAGCATTTGAGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921880826 1:220252896-220252918 AGCCAAGCAGCATTGTTTTGTGG + Intronic
921910713 1:220546114-220546136 AGGCAAGGAGCAGAGTGAGAGGG - Intronic
921938304 1:220814861-220814883 AGGCAAGCACCCATGTTTGAAGG + Exonic
922114571 1:222600010-222600032 ATGCAAGAAGAATTGTTTGATGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923086844 1:230708781-230708803 AGGCAGGGAGGATTGTTTGAAGG - Intronic
923321139 1:232834726-232834748 AGGCAAGGGACAGTTTTTGAAGG - Intergenic
1063491218 10:6465294-6465316 AGGCAAGCCACAGTTTATGACGG + Intronic
1065184475 10:23158593-23158615 AGCAAAGCAGCAGTGAATGAAGG - Intergenic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066018978 10:31277631-31277653 AAGCAAGCAGGAGTGGGTGATGG + Intergenic
1068512436 10:57983776-57983798 AGGCAAGCTGCATAGTGTGAGGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069921971 10:71821096-71821118 AGGCAAGAAGCAGTGCTTCCTGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072277057 10:93833769-93833791 ATGCAAGCAGCAGTGTCCTAAGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073580325 10:104659907-104659929 AGGGAACCAGCAATGTTGGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075139110 10:119815678-119815700 AGGACAGCAGGAGTGTCTGAGGG + Intronic
1075153024 10:119952261-119952283 AGGGCAGGAGCAGTATTTGAAGG + Intergenic
1075465049 10:122644925-122644947 AGGCAATCAGAACTGTTTGGTGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076465115 10:130674985-130675007 AGGAAAGCAGCAGAGTGTGGTGG + Intergenic
1078234464 11:9471419-9471441 AGGTGAGCAGTTGTGTTTGAAGG + Exonic
1078501395 11:11882134-11882156 GGGCAATGAGCAGTGATTGATGG - Intronic
1078518208 11:12042847-12042869 AGGAATCCAGCACTGTTTGAAGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081274184 11:41126620-41126642 AGGCCAGAATCAGTGTTGGAAGG - Intronic
1081698233 11:45133795-45133817 AGGCAAGCTGCTCTGTTTGGAGG - Intronic
1083393105 11:62369645-62369667 AGGCAATCAGCAGTTCCTGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085960175 11:81452562-81452584 AGGCAAGAAGCAATTTTTCAAGG - Intergenic
1087390943 11:97533823-97533845 AGGCAAGCTGCAGACTATGAGGG - Intergenic
1087650871 11:100866041-100866063 AAGGCAGAAGCAGTGTTTGAGGG - Intronic
1089176545 11:116552676-116552698 TGCTGAGCAGCAGTGTTTGAGGG + Intergenic
1089719777 11:120404684-120404706 ACGCAAGCAGCATTGTTTTAGGG + Intronic
1090003328 11:122980173-122980195 AGCGAAGCAGAAGGGTTTGAGGG + Intronic
1090285365 11:125495398-125495420 ATGCGGGGAGCAGTGTTTGACGG - Exonic
1090426835 11:126613278-126613300 TCGCACGCAGCAGTGTTTTAAGG + Intronic
1090530227 11:127583230-127583252 AGGCAAGCAGACGAGTATGAAGG - Intergenic
1091576853 12:1745024-1745046 AGCCAATCAGCACTGTTTGGTGG + Intronic
1092478247 12:8837358-8837380 AGGGAAGAAGTGGTGTTTGAGGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093146324 12:15571100-15571122 AGGGAAGCAGCACAGTTTCAGGG + Intronic
1093855503 12:24096984-24097006 TTCCAACCAGCAGTGTTTGAGGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094793344 12:33940183-33940205 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095104619 12:38216935-38216957 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1096186014 12:49581049-49581071 AGGCAATAAATAGTGTTTGAGGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1100983692 12:100185280-100185302 AGCCAAGGAGCACAGTTTGATGG - Intergenic
1101709166 12:107248938-107248960 AGGGAAGCAGCAGGGTTTCCTGG - Intergenic
1102137982 12:110591248-110591270 AGGAAAACAGCAGTGTCTAAAGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104087772 12:125492329-125492351 TGGCATGCAGCAGTGTTTGGAGG - Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104308843 12:127635516-127635538 AGGCAAGCTGCACAGGTTGAGGG + Intergenic
1104561917 12:129853467-129853489 AGGCAAGCAGGAAGGCTTGAAGG - Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105994131 13:25654061-25654083 AGGCAAACAACAGTTTCTGAGGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109578614 13:64295745-64295767 AGTGAAGCAGCAGTTTTTGGGGG + Intergenic
1109676454 13:65681862-65681884 AGGAGAGCAGCAGTGGTTTATGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110440536 13:75521061-75521083 ATGCAAAAAGCAGTGTTTTAAGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111263332 13:85773244-85773266 AGGCAAGCTGCAGTGTTATGAGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1113239195 13:108317271-108317293 AGGTAATCAGCAGTGTTTGTTGG - Intergenic
1113704909 13:112423627-112423649 GAGCAAGGGGCAGTGTTTGAAGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114390319 14:22301150-22301172 AGGCAAAAAGCAATGTTGGATGG + Intergenic
1114411638 14:22506269-22506291 AGGCAGGCAGCAGTGTGCGTGGG - Intergenic
1117026681 14:51627743-51627765 AGGCATGGAGCAGTGAGTGAAGG - Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118093726 14:62512923-62512945 AAGCATGCTGCAGTGTTTGAAGG + Intergenic
1118112159 14:62733836-62733858 TGGGGAGCACCAGTGTTTGAAGG - Intronic
1118316625 14:64729807-64729829 AGGCAGGGAGCAGTGTTTCTAGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119451204 14:74712629-74712651 AGAAATGAAGCAGTGTTTGAGGG - Intronic
1121262078 14:92573747-92573769 TGGGAACCAGCAGTGTGTGAGGG - Intronic
1122501816 14:102205636-102205658 AGGCAGGCAGCAGTGTCTGTGGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123135835 14:106026816-106026838 AGGGAAGCAACAGTGTGTGCAGG - Intergenic
1123688019 15:22813428-22813450 AGTCCAGCTGCAATGTTTGATGG - Intronic
1123790172 15:23711821-23711843 AGGCAAGGAGGAGTGGTGGAAGG + Intergenic
1124149893 15:27167969-27167991 AGGCGAGCAGAAGTGATGGAGGG + Intronic
1124154342 15:27212203-27212225 ACGGAAGCAGTAGTGTCTGAGGG + Intronic
1125197269 15:37061342-37061364 AGGCCGGCAGAAGTGTTTAAGGG + Intronic
1125519267 15:40339165-40339187 ATGCCAGGAGCAGTGTCTGAGGG - Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127930889 15:63596781-63596803 TGGCAGGCAGCAGGGCTTGAAGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130931685 15:88433102-88433124 ATGCAAGCAGGAGACTTTGAAGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132001214 15:98181868-98181890 AGGAAAGTCTCAGTGTTTGAGGG - Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142541906 17:666311-666333 AGCCAAACAGAAGTGTTTGAAGG + Intronic
1143734433 17:8900600-8900622 AGGCCATCAGCAGTGAGTGATGG + Intronic
1143813236 17:9489530-9489552 AGGTAAGCTGCAGTGTCTGCGGG - Intronic
1146085624 17:29825913-29825935 AGGTAAGCAGCAGTATTTCCTGG - Intronic
1147397233 17:40153608-40153630 TGACTAGCAGCAGTGTATGAGGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151025430 17:70671327-70671349 AGCCACGCAGCTGTGTGTGAGGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152866839 17:82729221-82729243 TGGCAAACACCCGTGTTTGAGGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153610135 18:6876451-6876473 AGGCAAGCAGCAGTTTTTGATGG - Intronic
1153610138 18:6876509-6876531 AGGCAAGCAGCAGTTTTTGATGG - Intronic
1153775840 18:8452763-8452785 AGGGAAGCAGCTTTGTTGGATGG - Intergenic
1155752348 18:29441302-29441324 AGGCAAGGGACAGTGTGTGAAGG + Intergenic
1156300465 18:35832105-35832127 AGGCAAGGATGGGTGTTTGACGG - Intergenic
1156450611 18:37264355-37264377 AGGCCAGCAGCAATGATTGAGGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158087101 18:53664235-53664257 ATTCAAGCAGCAGTTTTTCATGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159062349 18:63529203-63529225 AGGCAAGGGGAAGTTTTTGAAGG + Intergenic
1159108779 18:64032355-64032377 AGGCAAGCAGCTGGCTTTGATGG + Intergenic
1159131776 18:64288175-64288197 AGGGAAGCAGGAGTGTTCCATGG - Intergenic
1160078547 18:75702113-75702135 AGAGAAGGAGCAGTGTGTGAAGG + Intergenic
1160910493 19:1471686-1471708 AGGAACGAAGCAGGGTTTGAGGG + Exonic
1161021531 19:2013723-2013745 AGGGGAGCAGCATGGTTTGAAGG + Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1165131758 19:33636956-33636978 GGGCAACCAGCAGTGGTTGGGGG - Intronic
1168075190 19:53977500-53977522 AAGCAAGCAGAGGTGTGTGAGGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
927035422 2:19170250-19170272 AGGGAAGGAGCACTGTGTGAAGG + Intergenic
927546141 2:23955216-23955238 AGGCAAGCAGCCGGGTGCGATGG - Intronic
928275843 2:29899349-29899371 CTGCAAGCAGCTGTGTGTGAAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
928713000 2:34028580-34028602 AGGCAAACAGTAGTGATTTATGG - Intergenic
929422122 2:41802940-41802962 AGGCAAAAATCAGAGTTTGAAGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929620578 2:43350201-43350223 AGGCAGGCAGAAGTATTTTATGG + Intronic
929635707 2:43519015-43519037 AGGCAAGCAGGAGGGCATGATGG - Intronic
929688521 2:44055425-44055447 ATGCAATCTGCAGTGTTTGGAGG + Intergenic
930025552 2:47027168-47027190 AGTGAAGCAGCAGTGTGTGGGGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931622177 2:64221890-64221912 TAGCAGGCAGCAGTGTTTGGAGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933478579 2:82823631-82823653 AGGAAAGCAGAAGTATTAGAAGG - Intergenic
933559116 2:83869933-83869955 AGAAAAGCAGTAGTATTTGAAGG + Intergenic
934917675 2:98313379-98313401 AGGCAAGGAACAGTGCTTGTGGG + Intergenic
935760729 2:106318266-106318288 AGGGAAGCAGCAGGGTTTGAGGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937866093 2:126752877-126752899 GAGCCAGGAGCAGTGTTTGAGGG - Intergenic
939106983 2:137960670-137960692 AGAGAAGCAGCACAGTTTGAAGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940141117 2:150491516-150491538 ACTCCAGCAGAAGTGTTTGAAGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941650162 2:168083897-168083919 AGGCAACCAGCATTGACTGACGG + Intronic
941891052 2:170582375-170582397 AGGGAAGCAGCACTGTTTGCAGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
944513930 2:200492097-200492119 AGGCAGGCAGGAGTGGTTTACGG - Intronic
944648717 2:201807084-201807106 AGGCAAGCTGCAGTATTAGTTGG + Intronic
945304780 2:208248918-208248940 AGGCAAAGGGCAGAGTTTGATGG - Intronic
946764584 2:223028352-223028374 AGGAAAGCACAAGTCTTTGATGG + Intergenic
947468728 2:230380455-230380477 ATGCATGCAGAAGTATTTGAGGG - Intronic
1168890270 20:1291172-1291194 AGGCAACCAGCATAGGTTGAGGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1172971723 20:38878419-38878441 AGGCAACAAGCTGTGTATGAAGG - Intronic
1173748968 20:45461268-45461290 TGGCAAACATCAGTGTTTGAGGG + Intergenic
1175041767 20:56058844-56058866 ATGCAAACTGCAGTGTATGAAGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177513984 21:22123627-22123649 AGGAGAGAAGAAGTGTTTGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178465633 21:32844918-32844940 AGGACAGCAGCCGTGATTGATGG + Intergenic
1178599680 21:33984963-33984985 AGGCAAGTAGCTGGGTTTGATGG + Intergenic
1179170647 21:38970374-38970396 GGGCATGCAGAAGTGTTTGTGGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1180053539 21:45344969-45344991 AGCCAAGCAGCTGTGGTTGACGG + Intergenic
1180875437 22:19173008-19173030 TGGCACGCAGCAGTGTGTGAGGG + Intergenic
1181898391 22:26131428-26131450 TGGGAAGCTGCAGTGTTTGCTGG + Intergenic
1182247674 22:28972718-28972740 TTGCCATCAGCAGTGTTTGAGGG + Intronic
1183266883 22:36833302-36833324 ATGCAAGCAACAGTGTCTGATGG + Intergenic
1183267240 22:36836037-36836059 ATGCAGGCAACAGTGTCTGATGG + Intergenic
1185309154 22:50144139-50144161 AGGTCAGCAGCACTGTTGGAGGG - Exonic
949212186 3:1516230-1516252 AGGCAACCAGCAGTCCTGGAGGG + Intergenic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
952941907 3:38452158-38452180 AAGCAAGAAGCAGTGTTGTATGG - Intergenic
954548837 3:51463169-51463191 CTGCAAGCTGCAGTGTTTAAAGG + Exonic
954897848 3:53992184-53992206 AGGTAAGCAGAAGTGTTGCATGG - Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956626914 3:71275571-71275593 AGACAAGCAGGTGTCTTTGATGG + Intronic
959538520 3:107513995-107514017 AGGCCAGGAGCATTGTCTGAAGG - Intergenic
959631434 3:108511426-108511448 AGGCAAGTATCAGTCTTAGAGGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960474253 3:118104812-118104834 AAGCAAGCTGCAATGTTGGAGGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963208261 3:142658515-142658537 AGGCAAGGAGCAGGGCTTGCAGG - Intronic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964224030 3:154376654-154376676 AGGAAAGCAGCAGTGTTCACTGG + Intronic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966822153 3:183933509-183933531 AGGCCAGCAAAAGTGTTTTAAGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969712725 4:8853358-8853380 AGCCAAGAAGGAGAGTTTGAGGG + Intronic
970234192 4:13941774-13941796 AGGCAAGAAGTAGTTGTTGAAGG - Intergenic
970918387 4:21363436-21363458 AGTGAACCAGGAGTGTTTGAAGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975550419 4:75607364-75607386 AGACAAGAAGCAGAGTGTGACGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978228985 4:106375108-106375130 AGGCAATCAGCTGGGTGTGATGG - Intergenic
978424466 4:108567685-108567707 AGGAAATCAGCAGTGTTTGCTGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979469621 4:121079264-121079286 AAGCTAGCAGCAGTGTTGGGAGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
981607990 4:146560488-146560510 AGGCAAGAAGCACTGTTTATTGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983653976 4:170062424-170062446 AAGCAGGGAGCAGTATTTGAGGG + Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984498501 4:180529785-180529807 AGACAAGCATCAGTGATTTACGG + Intergenic
985841254 5:2307704-2307726 AGGCACGCAAAAGTGTGTGATGG + Intergenic
985842552 5:2319468-2319490 AGGCAATCGGCAGTGTCTTAAGG - Intergenic
987662279 5:20892691-20892713 AGGCAAGGAGCAGAGGTAGAAGG + Intergenic
987695974 5:21332632-21332654 GAGTAAGAAGCAGTGTTTGATGG - Intergenic
987700689 5:21394188-21394210 ATGCAAATACCAGTGTTTGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988678370 5:33458004-33458026 AGGCAGCCAGCAATGATTGATGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988756227 5:34253978-34254000 CAGAAAGAAGCAGTGTTTGATGG + Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
991744423 5:69719460-69719482 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
991753281 5:69835773-69835795 CAGTAAGAAGCAGTGTTTGATGG - Intergenic
991795995 5:70299184-70299206 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
991802898 5:70392500-70392522 CAGTAAGAAGCAGTGTTTGATGG - Intergenic
991823804 5:70594774-70594796 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
991832602 5:70710892-70710914 CAGTAAGAAGCAGTGTTTGATGG - Intergenic
991888373 5:71298744-71298766 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994722241 5:103393526-103393548 GGGCAAGCAGCTGGGCTTGAGGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996694292 5:126376742-126376764 AAGGAAGCAGCACTGTTTTAAGG + Intronic
997059651 5:130486269-130486291 AGCCATGCAGAAGTGTTTAAGGG + Intergenic
997521789 5:134527756-134527778 AGGCCAGCGGCAGTGGCTGAGGG - Intronic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
999966849 5:156819298-156819320 AGACAAGTGGCAGGGTTTGAAGG + Intergenic
1000785004 5:165532281-165532303 AGGCAAGAATCAGTGTCTGGGGG + Intergenic
1001126544 5:169024626-169024648 AGGCGAGCAGCAGTGTTTGTCGG + Intronic
1001796811 5:174509265-174509287 ATGCAAGCAGAAGTGTTGCAAGG - Intergenic
1002431409 5:179206405-179206427 AGGCAGGCAGCAGGGTGTGCAGG - Intronic
1003106359 6:3219441-3219463 ATGCAAGCAGAAGTCATTGAGGG + Intergenic
1003110304 6:3247605-3247627 ATGAAAGCAGCTGTGTTTCAAGG - Intronic
1004523727 6:16386212-16386234 TGGCAAGGAGGAGTGATTGATGG - Intronic
1004758739 6:18642441-18642463 AGGCAAGCAGCACCTTTTAAAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005554814 6:26965426-26965448 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
1006422263 6:33942469-33942491 AGGGCAGCAGCTGTGTTTGGAGG - Intergenic
1006567412 6:34972144-34972166 ATCCAAGCAGCTGTGTTTCAAGG - Intronic
1007304301 6:40892233-40892255 AGGCAAGTAGTAGGGATTGAAGG - Intergenic
1007450602 6:41938599-41938621 AGGCAAGGGGTTGTGTTTGAGGG + Intronic
1008090709 6:47291110-47291132 AGGCAAGAAGCAGTGAAAGAGGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009029787 6:58042934-58042956 ATGCAAGCAGAAGTGTTGTATGG + Intergenic
1009483819 6:64194968-64194990 TTGCAAGCAGCAATGTTTTAAGG - Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1010103330 6:72137303-72137325 AGCAATTCAGCAGTGTTTGAAGG + Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016693433 6:146965354-146965376 ATGCAGGCAGCAGTGTTCCAAGG - Intergenic
1017872040 6:158494557-158494579 AGGCACGCAGCAGTGAGTGGGGG - Intronic
1018828075 6:167422992-167423014 GGGGAAGCCGCAGTGTATGAGGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022643957 7:32213621-32213643 AGGCAAGCAGCAGTGTTTGAGGG - Intronic
1023090109 7:36609388-36609410 AGGCAAGCAGGAGCCATTGAAGG - Intronic
1026808205 7:73441111-73441133 AGGCAAGCAGCAACATTGGAGGG - Exonic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030353731 7:108520420-108520442 AGGCTAGGAACAGTGTGTGAGGG + Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1030932203 7:115538005-115538027 AGGCAAACAGAAGCGTTTTAGGG + Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031797174 7:126189359-126189381 AGACAACCAACAGAGTTTGAAGG - Intergenic
1033267322 7:139897398-139897420 AGGCAGGGAGCAGGGTGTGAAGG + Intronic
1033452901 7:141477525-141477547 AGTAAATCAGCAATGTTTGAAGG + Exonic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034275672 7:149822822-149822844 AGGGGAGCAGCTGGGTTTGAGGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035055873 7:156035842-156035864 AGGCACACATCAGTGTGTGATGG - Intergenic
1035954777 8:4064671-4064693 AGGGCAGCAGCAGTGTTGGAGGG - Intronic
1039113780 8:34069461-34069483 AGACTAGCAGAAATGTTTGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039820473 8:41129905-41129927 AGGCAAGTAGCATTGTTCCATGG + Intergenic
1041828779 8:62128692-62128714 TGGTATGCAGCAGTGTTTGGGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043095784 8:75970279-75970301 AGGCAACCAGCTGTATTTAAGGG - Intergenic
1043143848 8:76625719-76625741 AAGCAAGCAGCAATGTTAGAAGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047256613 8:123218045-123218067 AGGCGAGCAGCAGTGAAGGATGG + Intergenic
1047855486 8:128905428-128905450 ATGCAAGCTGCAGAGGTTGAGGG - Intergenic
1048081473 8:131132798-131132820 AGGCAAAGAGCAGTGTGAGAAGG - Intergenic
1048563837 8:135572595-135572617 AGACCAGCAGCAGTGCTTGAGGG + Intronic
1050288618 9:4130472-4130494 ATGCAGGGAGCAGTGTTTGGAGG - Intronic
1051128415 9:13832214-13832236 AGGAAAGCAGCAGCATTTAAGGG - Intergenic
1051427133 9:16943647-16943669 AGGCCCGCAGCAGTGTCTGAAGG - Intergenic
1051612141 9:18971282-18971304 AGGCAAGCAGCAGTGGGGCATGG - Intronic
1052605872 9:30699860-30699882 AGAGAAGCAGCTGTGTTGGAAGG - Intergenic
1052969100 9:34365561-34365583 AGGCAGGCAGGAGTGTCTGACGG - Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055808686 9:80125961-80125983 AGGCCTGAAGCAGTGTTTGGAGG - Intergenic
1058650765 9:107174091-107174113 AGACAGGGAGCAGTGTCTGATGG + Intergenic
1060044761 9:120331139-120331161 AGGGAAGATGGAGTGTTTGAAGG - Intergenic
1060355787 9:122905557-122905579 AGGCAAGCCGAAGGGATTGATGG + Intergenic
1186451860 X:9680569-9680591 AGGCAAGCAGGAGGGCTGGATGG - Intronic
1188870398 X:35364689-35364711 AGGCAAGCAGCAGCCTCTGTTGG - Intergenic
1189010459 X:37042040-37042062 AGGTGATCAGCTGTGTTTGAGGG + Intergenic
1189688956 X:43595346-43595368 AGGCAAGCAGCAATTTTGAAAGG + Intergenic
1190295470 X:49024523-49024545 AGGCAGGGAGCACTGGTTGAGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191782962 X:64888180-64888202 AGGCACAGAGCAGTGTTTGCTGG - Intergenic
1191815162 X:65235986-65236008 AAGCATGCAGTAGTCTTTGAAGG + Intergenic
1191897466 X:66008260-66008282 AGCTAGGCAGCAGGGTTTGAGGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193300354 X:79881600-79881622 AGGGAAGCAGCAGTGGGTAAAGG - Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196008787 X:110864242-110864264 AGGCCATCAGCATTGTTGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197482554 X:127005011-127005033 AGGGAAGCTGCAGTGTTGGGAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1201782790 Y:17741824-17741846 AGGCAAACATGAGTGTTCGACGG + Intergenic
1201818763 Y:18164164-18164186 AGGCAAACATGAGTGTTCGACGG - Intergenic