ID: 1022644242

View in Genome Browser
Species Human (GRCh38)
Location 7:32215926-32215948
Sequence CTTTGCCACAGCCCTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022644235_1022644242 16 Left 1022644235 7:32215887-32215909 CCTGCAAGGAAATCTGCCCAGTG 0: 1
1: 0
2: 5
3: 18
4: 151
Right 1022644242 7:32215926-32215948 CTTTGCCACAGCCCTGGGTCTGG No data
1022644239_1022644242 -1 Left 1022644239 7:32215904-32215926 CCAGTGCACTGGTTGGCTGCTGC 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1022644242 7:32215926-32215948 CTTTGCCACAGCCCTGGGTCTGG No data
1022644238_1022644242 0 Left 1022644238 7:32215903-32215925 CCCAGTGCACTGGTTGGCTGCTG 0: 1
1: 0
2: 1
3: 12
4: 216
Right 1022644242 7:32215926-32215948 CTTTGCCACAGCCCTGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022644242 Original CRISPR CTTTGCCACAGCCCTGGGTC TGG Intronic
No off target data available for this crispr