ID: 1022648703

View in Genome Browser
Species Human (GRCh38)
Location 7:32255382-32255404
Sequence CAAGTTAAAAAGTTTGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022648703_1022648704 -1 Left 1022648703 7:32255382-32255404 CCACACTCAAACTTTTTAACTTG 0: 1
1: 0
2: 3
3: 23
4: 244
Right 1022648704 7:32255404-32255426 GAGAGCGCATCAGAAACACTTGG 0: 1
1: 0
2: 1
3: 21
4: 208
1022648703_1022648705 6 Left 1022648703 7:32255382-32255404 CCACACTCAAACTTTTTAACTTG 0: 1
1: 0
2: 3
3: 23
4: 244
Right 1022648705 7:32255411-32255433 CATCAGAAACACTTGGCCTCTGG No data
1022648703_1022648706 13 Left 1022648703 7:32255382-32255404 CCACACTCAAACTTTTTAACTTG 0: 1
1: 0
2: 3
3: 23
4: 244
Right 1022648706 7:32255418-32255440 AACACTTGGCCTCTGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022648703 Original CRISPR CAAGTTAAAAAGTTTGAGTG TGG (reversed) Intronic
903285617 1:22275074-22275096 CAAGCTATATAGTGTGAGTGGGG - Intergenic
905550198 1:38831359-38831381 CAAGTAAAATAGTCTGGGTGAGG - Intergenic
906047788 1:42846150-42846172 TAAGTTATAAACCTTGAGTGAGG + Intergenic
906848659 1:49223424-49223446 CAAGTGTAAAAGTTTATGTGGGG + Intronic
907062192 1:51439840-51439862 CAAATTACAAGGTTTGTGTGAGG + Intronic
907596296 1:55723160-55723182 CAAGTTAAATAGTTTGTCTGTGG - Intergenic
907805738 1:57817636-57817658 CAAATCAATAATTTTGAGTGGGG - Intronic
909457582 1:75867924-75867946 CAATTTTAAAAATTTGAGTATGG - Intronic
910227026 1:84946222-84946244 AAAGGTAATAAGTTTGAGTGGGG - Intronic
912113040 1:106367150-106367172 CAAGATAAGAAGTTTGGCTGTGG + Intergenic
912902832 1:113671280-113671302 CAGGTTCAAAGGTGTGAGTGTGG + Intronic
913166833 1:116195584-116195606 CAGGTCAGAAAGTTTGAGAGAGG + Intergenic
913365814 1:118037242-118037264 AATGTAAAAAAGTTTAAGTGTGG - Intronic
914441739 1:147713546-147713568 CCAGGTAAAATGTTTCAGTGTGG - Intergenic
916558603 1:165913731-165913753 CAAGTAAAAAAATGTGAGTTAGG + Intergenic
917473584 1:175348372-175348394 CAAGTTAAAATTTTTGAGGGGGG + Intronic
918626511 1:186661643-186661665 CATGTTAATTAGTTTGATTGTGG + Intergenic
918694657 1:187530127-187530149 CAAGCTAAAAAGTTTTAGAAAGG - Intergenic
920806642 1:209240832-209240854 AATACTAAAAAGTTTGAGTGGGG - Intergenic
921355097 1:214278661-214278683 CCAGTTAAAGCGTTTAAGTGAGG - Intergenic
923278825 1:232421776-232421798 GAAGTTAAAAAGTGGGAGAGTGG - Intronic
924258011 1:242201912-242201934 CAACATAAAAAGTGTGTGTGTGG + Intronic
924666408 1:246077405-246077427 CAAGTTAGAAAGCCTTAGTGAGG + Intronic
1062883737 10:999998-1000020 CAATTTACAAAATTAGAGTGTGG - Intronic
1063566705 10:7177572-7177594 GAAGATGAAAAGTTTGAGTGTGG + Intronic
1064321171 10:14306141-14306163 CAAGTTAGAAATTTAAAGTGGGG + Intronic
1066091004 10:32020432-32020454 CCAGTTAAGAATTTTGAGTCAGG + Intronic
1066335008 10:34467531-34467553 CAAGTCCAAAAGTTTGAGACTGG + Intronic
1066747444 10:38615566-38615588 CCAGTTAAAAGGGTTCAGTGTGG - Intergenic
1068144337 10:53047214-53047236 CAAGTTAAAAAACTTGACAGTGG + Intergenic
1068700317 10:60012860-60012882 CATGCTAAATAGTCTGAGTGTGG - Intergenic
1070987963 10:80704576-80704598 CAAGTTAATTAGTTTGATTGTGG + Intergenic
1071356617 10:84802847-84802869 CAAGTGTCAAAGTGTGAGTGTGG + Intergenic
1072098776 10:92209027-92209049 AAAGATAAAAAGATTAAGTGAGG - Intronic
1072669968 10:97422132-97422154 CAATTCAGAAAGTGTGAGTGTGG - Intronic
1073622119 10:105060646-105060668 AAAGTTAAAAAGTCTGGGCGCGG + Intronic
1074914804 10:117945307-117945329 CAAGTCATACAGTTTGTGTGTGG + Intergenic
1077752120 11:4983780-4983802 CTACTTAAAAAGTTTGATTTTGG + Intronic
1079635316 11:22731599-22731621 GAAGTAAAAAGGTTTGTGTGTGG + Intronic
1080147214 11:29001102-29001124 CAAGTCATAAAGTTTGTGTGTGG + Intergenic
1083699559 11:64466742-64466764 CACATTAAAAAGTATGAATGAGG - Intergenic
1085372046 11:76018090-76018112 AAAGTAAAAAGGGTTGAGTGGGG + Intronic
1088043615 11:105420051-105420073 CAATTGAAAAGCTTTGAGTGAGG + Intergenic
1089548945 11:119255140-119255162 GAAGTTAAAAAGCGTGAGTTTGG + Intronic
1091169614 11:133508468-133508490 CAAGTTAGGCAGTTTTAGTGAGG + Intronic
1092989204 12:13878516-13878538 CAAATTAAACAAATTGAGTGCGG + Intronic
1093153573 12:15653340-15653362 CATGCTAAAGAGTTAGAGTGTGG - Intronic
1093670888 12:21874350-21874372 AAAGATAAAAAGTGTTAGTGAGG + Intronic
1093763460 12:22936621-22936643 TAAGTTAACTAGTTTGATTGTGG - Intergenic
1094222756 12:28012274-28012296 CAAGATAAAAATGTGGAGTGTGG + Intergenic
1094258993 12:28470093-28470115 CAAGTTAAAAAGCTTCTGTATGG + Intronic
1094534236 12:31306854-31306876 CTAGTTAACAAGTTTGAGTCAGG + Intronic
1095568121 12:43650064-43650086 CAAGCCAAAAAGTGAGAGTGAGG + Intergenic
1098551785 12:71770418-71770440 TAACTTAAAAATTTTGTGTGTGG + Intronic
1099544749 12:83964540-83964562 CAAGGTATAAAGTTTCAGTTAGG - Intergenic
1100289040 12:93196386-93196408 CAAAATAAAAAGTTGGGGTGGGG - Intergenic
1100297313 12:93275008-93275030 CAAGTTAAAATGATTTATTGGGG + Intergenic
1101236784 12:102797714-102797736 TAAGTTAAAAAGTTTTATTTAGG - Intergenic
1102366087 12:112336191-112336213 CAAGGCAGAAAGTTTGTGTGTGG + Intronic
1102638538 12:114346058-114346080 CAAAATAAAAAGTTTAAGAGAGG + Intergenic
1102732534 12:115125644-115125666 CAAGCTAGAAAGGTTGGGTGAGG - Intergenic
1102921878 12:116797551-116797573 AAAGTTATTAAGTTAGAGTGAGG + Intronic
1108903135 13:55437106-55437128 CAACTTAAAAATTATGCGTGGGG + Intergenic
1109438671 13:62340606-62340628 TATGTTAAAAAATTTGACTGTGG - Intergenic
1109761142 13:66830785-66830807 CAACTTAAAAAATTTCAGGGGGG + Intronic
1110618536 13:77569319-77569341 GAAATGAAAAAGTTTGAGAGTGG + Intronic
1112260014 13:97869288-97869310 CAAGTTGGAATGTTGGAGTGTGG + Intergenic
1113292246 13:108919956-108919978 CAAATTAAAATATTTGACTGGGG + Intronic
1114292545 14:21300373-21300395 CAACATAAGAATTTTGAGTGGGG + Intronic
1114297746 14:21345243-21345265 GAAATTCAAAAGTTTGAGTTTGG + Intronic
1115388115 14:32821491-32821513 CAAGTTAATTAGTTTGAATGAGG + Exonic
1115800595 14:36989309-36989331 GAAATTAAAAAGTTTTAGAGGGG - Intronic
1115842008 14:37482785-37482807 AAAGTTAACAAGTGTCAGTGAGG + Intronic
1116040814 14:39684529-39684551 CAAGTTAATAAGTTTGGGGTGGG + Intergenic
1116221107 14:42088463-42088485 CAATATAAAAAGTTAGAGTTAGG + Intergenic
1116321754 14:43476307-43476329 CATTTCAAATAGTTTGAGTGTGG - Intergenic
1116383796 14:44305617-44305639 CAACTTAAAATGTTTTATTGAGG + Intergenic
1116634052 14:47371540-47371562 CCAGTTAAATAGTTTGAGGATGG + Intronic
1117232337 14:53733451-53733473 AAAGTTAAAAAGTGTTGGTGAGG + Intergenic
1117600989 14:57374342-57374364 AGAGGTAAAAAGATTGAGTGTGG + Intergenic
1117682524 14:58219381-58219403 CAAGATTAAAAGATTGTGTGTGG + Intronic
1118008266 14:61584815-61584837 CAAGAAAAAAAATTTGAGTTTGG - Intronic
1119068082 14:71550985-71551007 CAAGGTAAAAAGTGCCAGTGTGG - Intronic
1120696001 14:87646219-87646241 CTAGTTCAAAATTTTGTGTGTGG - Intergenic
1202932118 14_KI270725v1_random:47293-47315 AAAGTTAAATAGTTAGGGTGGGG + Intergenic
1124175531 15:27420580-27420602 CATGTTAATTAGTTTGATTGTGG + Intronic
1125191559 15:36999871-36999893 CATGTTAAAAATTTTAAATGAGG - Intronic
1127473378 15:59310196-59310218 CAAGTTGACCAGCTTGAGTGTGG + Intronic
1127825136 15:62696334-62696356 GAAGGTAAAAAGTCTGAGGGTGG - Intronic
1133087689 16:3377836-3377858 CTAGTTAAAATGTTTCAGTGAGG + Intronic
1133574029 16:7070153-7070175 AAAGTTAAAAAACTTGAGTTTGG + Intronic
1137992205 16:53169797-53169819 CAAGTTAAAAATTTTGAATTTGG - Intronic
1138725039 16:59126997-59127019 CAGGTTTAAAAGTCTGATTGGGG + Intergenic
1138873223 16:60918083-60918105 AAAATTAAAATGTATGAGTGTGG + Intergenic
1139149586 16:64365426-64365448 TAAGATAAAGAGTTTGATTGTGG + Intergenic
1140417870 16:74789389-74789411 GTAGTTAAAAAATTTGTGTGGGG - Intergenic
1140668678 16:77252335-77252357 CAAGGTACAAAGTTTCAGTTAGG - Intronic
1141303916 16:82843113-82843135 CAACTTAAAAAGTTTAAGGGTGG - Intronic
1141920004 16:87129284-87129306 TAAGTTAAGGAGTTTGAGTTGGG - Intronic
1143349498 17:6277079-6277101 GAAGTTAAGAAGCTTGTGTGGGG - Intergenic
1144533424 17:16063014-16063036 CACGTTAGAAGGTTGGAGTGAGG - Intronic
1145400691 17:22529880-22529902 CATGTTAATAATTTTTAGTGAGG - Intergenic
1146968505 17:37053579-37053601 CAAGTTAAAAAGTTTATGTGTGG + Intronic
1149108909 17:53002333-53002355 CAATTTCAAAAGTTTTATTGTGG - Intergenic
1149410997 17:56406756-56406778 TAAGTTATAGAGTTAGAGTGAGG + Intronic
1150516879 17:65821941-65821963 CAATTTAAAAAATATGTGTGGGG + Intronic
1150802126 17:68291042-68291064 CATGTTTAAAAGTTTGATTGTGG - Intronic
1154293159 18:13127972-13127994 ACAGTTAAAAAGTTTGAGCTGGG + Intergenic
1155259869 18:24031316-24031338 CAAGTGAAAAAGATTGTGAGTGG + Intronic
1155638090 18:27978949-27978971 CTATTTAAAAATTTTGAGTGGGG - Intronic
1155719731 18:28995950-28995972 CAATTTAAAAAGTTTGGGAAGGG - Intergenic
1156044616 18:32863547-32863569 CAAGTAAAAATTTTTAAGTGGGG - Intergenic
1156973858 18:43192625-43192647 GATATTCAAAAGTTTGAGTGTGG - Intergenic
1157886262 18:51369821-51369843 CAAGTTAAAAAAGATGAGAGGGG - Intergenic
1159123191 18:64193574-64193596 CAAGGAAAAGAGTTTCAGTGAGG + Intergenic
1160180723 18:76633658-76633680 CTAGTGAAAATGTTTGAGTCTGG + Intergenic
1163905217 19:20146541-20146563 TAAGATTAAAAGTTTGAGTGGGG + Intergenic
1167786323 19:51640206-51640228 CAAGTTATAAGCTTTGAATGGGG + Intronic
925926121 2:8671835-8671857 CAATGTAAAGAATTTGAGTGTGG - Intergenic
926591730 2:14747709-14747731 CAAATTAAAGAGTGGGAGTGAGG - Intergenic
928070896 2:28215278-28215300 CAAGTTAAAGAGTTTGCTTAAGG - Intronic
928257253 2:29733487-29733509 GAAGTTAAATAGTTTGCCTGAGG - Intronic
929178239 2:39003709-39003731 GAACTTTATAAGTTTGAGTGGGG - Intronic
930255131 2:49081993-49082015 CAAGTTTAAAAGTTAAAGTTAGG + Intronic
930374416 2:50546958-50546980 CAAGTAGAAATGTTTAAGTGTGG + Intronic
931536751 2:63286159-63286181 AAAATTTAAAAATTTGAGTGTGG - Intronic
933263420 2:80154802-80154824 GAAATTAAAAAGTTTGAGAATGG - Intronic
934637678 2:96005814-96005836 CATGTTGAAATGTTTGAGGGGGG + Intergenic
935467288 2:103413751-103413773 CAATTTAAAAATTTTAAATGAGG + Intergenic
936902126 2:117493280-117493302 CAACATACAAATTTTGAGTGGGG + Intergenic
938586570 2:132696561-132696583 CAAGTTAAGAAGTTTATGTGGGG + Intronic
940656007 2:156488940-156488962 CAAGATAAAAATTTTGTGTTTGG + Intronic
940918081 2:159280155-159280177 CCAGTTAAAATGTTTAAGGGAGG - Intronic
942616567 2:177796982-177797004 CAAGTTAGTAATTTTCAGTGAGG + Intronic
943282002 2:185946450-185946472 CAAGGAAAAAAGTCTGTGTGTGG - Intergenic
943476484 2:188363789-188363811 CAAGTTAAGAAATTTGAGAGAGG + Intronic
943942273 2:194013754-194013776 CAAGGTAAAAAGATTGCTTGAGG - Intergenic
947320928 2:228917706-228917728 CAGTTTAGAATGTTTGAGTGGGG + Intronic
947422566 2:229954152-229954174 CAATTAAATAAGGTTGAGTGTGG - Intronic
947523917 2:230867101-230867123 CAACTGACAAAGTTTGAGGGAGG - Intronic
1169318825 20:4614346-4614368 CAAATTCAAAAGTCTGAGGGAGG + Intergenic
1170862144 20:20116410-20116432 CGAGTTAAAAAGTTTCTGCGCGG - Intronic
1171320813 20:24242530-24242552 GATGTGAAAAAGTTTTAGTGGGG - Intergenic
1172737239 20:37136185-37136207 AAATTTAAAAAGCTTGAGTGTGG + Intronic
1175655627 20:60767508-60767530 TAAGTTAAGAATCTTGAGTGGGG + Intergenic
1178170084 21:30030974-30030996 CAATTAAATAAGTTTGTGTGGGG + Intergenic
1178686166 21:34712492-34712514 CAAGCAAAGAAGTTTGAGTTGGG - Intronic
1180841039 22:18959003-18959025 GGAGATAAAAAGTATGAGTGGGG - Intergenic
1181060457 22:20279790-20279812 GGAGATAAAAAGTATGAGTGGGG + Intronic
1183556640 22:38533008-38533030 CAAGTTAAAAAGATTGAGCAGGG - Intronic
949276751 3:2292362-2292384 CAAGTTAACAAATATCAGTGGGG - Intronic
949540972 3:5031831-5031853 CTAGTTAAAAATTGTGTGTGGGG + Intergenic
951828583 3:26898132-26898154 CAAGTTAAAAAGCTTCTGTACGG - Intergenic
952871853 3:37907810-37907832 CATGTTAGAAAGTTTGCCTGTGG + Intronic
953866325 3:46586334-46586356 CAAGAAAAAAAGGTTGCGTGGGG + Intronic
955097151 3:55810616-55810638 AAAGTTCAAAACTTTCAGTGTGG - Intronic
955701892 3:61689926-61689948 CTAGCTAGAAAGTTTTAGTGGGG + Intronic
956476533 3:69627165-69627187 CAAGTTAAAAAGCTTTCGTATGG + Intergenic
958499757 3:94889946-94889968 TAACTGAATAAGTTTGAGTGTGG - Intergenic
958724188 3:97883681-97883703 CAGGTTAACAACTTTTAGTGAGG + Intronic
958777146 3:98499463-98499485 CATGTAAAAAAGTGTGATTGTGG + Intronic
959038530 3:101393713-101393735 CAAGCTGAAAAGTTTGAGACTGG + Intronic
959271337 3:104214571-104214593 GAAGTTAAAACGTTTGAATAAGG + Intergenic
960525779 3:118708273-118708295 TAAATTAAAAGGATTGAGTGAGG - Intergenic
960693154 3:120368515-120368537 CAAGTTAAATAATTTGACTAAGG + Intergenic
963018244 3:140846141-140846163 GAAGTTAAACAGTTTGAATAGGG + Intergenic
963918877 3:150886845-150886867 CAAGTTAAAGATCTTGAGAGTGG - Intronic
965539797 3:169860600-169860622 CAAGTTAAAAATCTTGAGGCTGG - Exonic
965841785 3:172913754-172913776 CAAGATAAAAATTATCAGTGTGG + Intronic
967380639 3:188853635-188853657 CAAGTTAAAACGTTTGGCTTTGG + Intronic
971954799 4:33402434-33402456 AAAAATAAAAAGTTAGAGTGAGG + Intergenic
973316947 4:48770887-48770909 CAAGGTAAAAATTTTAAGGGAGG - Intronic
973970928 4:56213144-56213166 CAAATTAAAGAGTTTAATTGAGG + Intronic
974192572 4:58525957-58525979 TGAGTTATAAAGTATGAGTGTGG + Intergenic
975948021 4:79731446-79731468 CACTTTACAAAGTTAGAGTGGGG + Intergenic
977166527 4:93705664-93705686 CAAGTTAAAAAGTTTCTGCATGG - Intronic
977528376 4:98171773-98171795 TAAGTCAAAATGTTTGAGTTAGG + Intergenic
978351745 4:107826385-107826407 CAAGTTAAACATTTTTAGTACGG + Intronic
979360679 4:119760876-119760898 CAAGTTTAAAGGTTTGAGGGAGG - Intergenic
979977675 4:127217129-127217151 TAAGTGAAGAAGTTTTAGTGAGG + Intergenic
981854236 4:149268279-149268301 CAAGTTAAAATGTCTGTGTCTGG + Intergenic
984438902 4:179740550-179740572 AAAGTTTAAGAGCTTGAGTGGGG - Intergenic
987841533 5:23228012-23228034 CAAGCTAAGAACTTGGAGTGGGG - Intergenic
989277257 5:39603416-39603438 TAAGTTAAAGAGTTTGAGATGGG - Intergenic
991168463 5:63592077-63592099 CTACTTTAAAAGTTTCAGTGTGG - Intergenic
991399761 5:66240372-66240394 AAAGATAAAAAGTTTGATTTTGG + Intergenic
992007861 5:72496103-72496125 CAAGTTAAACAGCTTTATTGAGG + Intronic
993330639 5:86595742-86595764 CATGTAGAAAAATTTGAGTGTGG - Intergenic
993481925 5:88434605-88434627 CAAGATAACAAGTATTAGTGAGG + Intergenic
994069323 5:95580921-95580943 GAAGTGAAAAAGTTTGAGAAAGG + Intronic
994446788 5:99885650-99885672 GAAGTTAAAAGGTTTGAGAAGGG - Intergenic
994742624 5:103640529-103640551 CAAGACAAAATGTTTGACTGGGG - Intergenic
999611738 5:153377214-153377236 CAAATTAAAAAGTTTGTTTTAGG + Intergenic
999859486 5:155630498-155630520 CAAGTTAAAAATTTTGCATGTGG + Intergenic
999952068 5:156661982-156662004 AAAAATAAAAAGTTGGAGTGGGG + Intronic
1001060597 5:168485375-168485397 AAAGTTACAAAGTTTCAGTTAGG + Intergenic
1002680238 5:180956300-180956322 AAAGGTAAAAAGTTTGAGTTAGG - Intergenic
1005182971 6:23127326-23127348 CAGGCTAAAAAGTCAGAGTGAGG - Intergenic
1006725240 6:36195405-36195427 CAAATTCAAAAGTTTGATTAAGG - Intergenic
1008658929 6:53645382-53645404 CAATTTAAAAAATTTTAATGGGG + Intergenic
1008715532 6:54284669-54284691 TAAGTAAAAATGATTGAGTGGGG + Intergenic
1009860721 6:69327642-69327664 CAAGTTGAAAAATATGAGAGAGG - Intronic
1010351495 6:74880340-74880362 GAAGTTAAAAAATTTGAGAAAGG + Intergenic
1010389733 6:75322992-75323014 CAAGTTAAAAAGTATAATTTTGG - Intronic
1010698659 6:79011802-79011824 CAAATTAAAGAGTTTGAGATTGG - Intronic
1011427668 6:87248389-87248411 CAAGTTAACAAGGTTGACAGAGG - Intronic
1012279664 6:97313960-97313982 TAAGTTAGAAAATTAGAGTGGGG + Intergenic
1015000301 6:128205808-128205830 CAAGTTAAAAAATATAAGAGTGG + Intronic
1015799528 6:137046071-137046093 CAAGTCAAAAAGTTTAGGTCGGG - Intergenic
1015905762 6:138114959-138114981 GAGGTTAAAGTGTTTGAGTGAGG - Intergenic
1016076243 6:139799510-139799532 AAAGTCAAAAATTTTGAATGGGG - Intergenic
1016297702 6:142592751-142592773 CACCTTAAAAAGTTTAAGTCTGG - Intergenic
1017255367 6:152327439-152327461 AAAGTTGAAAAGTTTAAGTCTGG + Intronic
1019084745 6:169465387-169465409 CAAAATAAAAAGTGTCAGTGAGG + Intronic
1020836464 7:13158309-13158331 CAACTTAAAAATTTTCAATGAGG - Intergenic
1021174633 7:17436933-17436955 TAAGATAAAAAGCTTAAGTGTGG + Intergenic
1021641419 7:22741197-22741219 CAAGTTAAAAAGCTTCCGCGTGG + Intergenic
1022077565 7:26988020-26988042 CAAGTTTAAATGTTGGAGTAAGG - Intronic
1022648703 7:32255382-32255404 CAAGTTAAAAAGTTTGAGTGTGG - Intronic
1024671771 7:51602252-51602274 TAAGTTCAATAGTGTGAGTGTGG - Intergenic
1025870742 7:65431673-65431695 CAAGTAGAAAAGTTTGAGCCTGG - Intergenic
1027487698 7:78782435-78782457 GATGTTAAACATTTTGAGTGTGG + Intronic
1027505327 7:79010979-79011001 TAAGTTCAAAAGCTTGATTGGGG - Intronic
1027967160 7:85026822-85026844 CAAGTAAAATAGTTTAGGTGGGG + Intronic
1028130745 7:87169731-87169753 CAAGTGAAAACGTTTCAGGGAGG - Intronic
1028542737 7:91961542-91961564 TAAGTTAAAAATATTGAGTTTGG + Intronic
1028619821 7:92812725-92812747 CATCTTAAAAAGTTTGAGTGTGG - Intronic
1028849403 7:95519818-95519840 GGAGTTAAAAATTTTGAGAGGGG + Intronic
1029063237 7:97821080-97821102 CAAGATAAAAAGTTGCAATGAGG + Intergenic
1030407331 7:109130551-109130573 CAAGTTAGAAAGATTGCTTGAGG - Intergenic
1031924468 7:127626058-127626080 CAAATTAAAAATTTTGAGCCAGG + Intergenic
1034485880 7:151362069-151362091 CAGGATAAAAAGATTGAGGGAGG - Intronic
1035283390 7:157791700-157791722 CAACAAAAAAAGTTTGAGAGAGG + Intronic
1036672595 8:10802099-10802121 CAAGTTAAAAAGGTAGTTTGGGG + Intronic
1038083428 8:24165896-24165918 GAAATTAAACATTTTGAGTGAGG + Intergenic
1039289199 8:36075733-36075755 CAAATTAAAAAGTTTGAGTAAGG - Intergenic
1042419506 8:68569289-68569311 CTAATTAAATAGTTTGAGTGAGG + Intronic
1042701415 8:71618904-71618926 TAAGTTAAAAACTTAGAGAGAGG + Intergenic
1043355503 8:79407122-79407144 CAAGTTATAAAATTTTATTGTGG - Intergenic
1045429567 8:102100924-102100946 TAAGTTACAGAGTTTGAGTTGGG + Intronic
1046442738 8:114280147-114280169 TAAGTTAAAATGTTTGAGATAGG - Intergenic
1046445223 8:114310805-114310827 CAACTCAAGAAGCTTGAGTGGGG - Intergenic
1047124222 8:121942577-121942599 CAAGTTATATAGTTTGAGTTTGG + Intergenic
1047231658 8:123002697-123002719 CAAATTCAAAAATTTGGGTGTGG + Intergenic
1051100168 9:13512425-13512447 CTAGTTAACATGTTTGGGTGGGG - Intergenic
1051201739 9:14633895-14633917 CAAGGCAAAATGTTTGGGTGGGG - Intronic
1051473687 9:17479035-17479057 AAAGATAATAAGTGTGAGTGAGG + Intronic
1055199456 9:73641642-73641664 TAAGTTAAGAAGCTTGAGTTTGG - Intergenic
1056432470 9:86541416-86541438 CAAGCTAACAAGTTTCACTGTGG + Intergenic
1056870798 9:90275943-90275965 AAAGTTAAAAAGTTACAGTAAGG - Intergenic
1056880107 9:90383405-90383427 CAAGATCAACAGCTTGAGTGTGG + Intergenic
1057591090 9:96374088-96374110 CAAAATAAAAAGTTTGGGAGAGG + Intronic
1059737726 9:117118908-117118930 CAGGGTAAAAAGATAGAGTGAGG - Intronic
1061011545 9:127958367-127958389 AAAATTAAAAACTTTTAGTGGGG + Intronic
1061955225 9:133957762-133957784 CAAGTAAAAATGGTGGAGTGTGG + Intronic
1203624281 Un_KI270749v1:155665-155687 AAAGTTAAATAGTTAGGGTGGGG + Intergenic
1185768131 X:2742912-2742934 CACGTTATAAAGTTAGAGGGTGG - Intergenic
1185825154 X:3242617-3242639 CAAGTTAAAAATCTTGAGATGGG + Intergenic
1187448418 X:19376842-19376864 CAAGTGAAACAGTGGGAGTGGGG - Intronic
1193377603 X:80780076-80780098 TAAGTTAAAAAGTTTAGGAGAGG - Intronic
1194439498 X:93913967-93913989 CAAATTAAAATATGTGAGTGTGG - Intergenic
1195479978 X:105333524-105333546 CAAGTTAAAAAGTTTCTGCATGG + Intronic
1195873670 X:109514955-109514977 CAATTTCAAAAGTTTGATTCTGG - Intergenic
1196362108 X:114874432-114874454 AAAGATAAAAAGTTTTGGTGAGG - Intronic
1196557226 X:117102007-117102029 CAAGCTAAAAAGCTTCTGTGTGG - Intergenic
1197308086 X:124868640-124868662 CAAGTTAAAAAGCTTCTGTACGG + Intronic
1198164319 X:134039166-134039188 CAAGTAGAAAAGTTTGAGCCTGG + Intergenic
1199498299 X:148479206-148479228 TAAGACAAAAAGTATGAGTGAGG + Intergenic
1200342915 X:155418188-155418210 CATGTTAATAAATTTGATTGTGG + Intergenic
1200486659 Y:3776963-3776985 TAAGTTAAGAAGTTTGAGATGGG - Intergenic
1201254016 Y:12089341-12089363 CAAGTTAAAAATCTTGAGATGGG - Intergenic