ID: 1022648706

View in Genome Browser
Species Human (GRCh38)
Location 7:32255418-32255440
Sequence AACACTTGGCCTCTGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022648703_1022648706 13 Left 1022648703 7:32255382-32255404 CCACACTCAAACTTTTTAACTTG 0: 1
1: 0
2: 3
3: 23
4: 244
Right 1022648706 7:32255418-32255440 AACACTTGGCCTCTGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022648706 Original CRISPR AACACTTGGCCTCTGGCTTC AGG Intronic
No off target data available for this crispr