ID: 1022648956

View in Genome Browser
Species Human (GRCh38)
Location 7:32257578-32257600
Sequence CAGAATAATTACAAGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022648956 Original CRISPR CAGAATAATTACAAGGTGCC AGG (reversed) Intronic
902857987 1:19223082-19223104 TTGAATCATTACTAGGTGCCAGG + Intronic
904278170 1:29397657-29397679 AAGAATAATTACAAGACGACAGG - Intergenic
907071842 1:51542602-51542624 TGGAATAATTACCATGTGCCAGG + Intergenic
907088438 1:51701233-51701255 TAGAAGAATTACAATGGGCCGGG - Intronic
908097501 1:60754480-60754502 CAAGATAATTACAACATGCCAGG + Intergenic
908343319 1:63205255-63205277 CTGAATAATGACATGGAGCCAGG - Intergenic
908814924 1:68021978-68022000 CAAAATAATAACAAGAAGCCAGG + Intergenic
908829730 1:68167227-68167249 CAAAATAATTACCAGGTTTCAGG + Intronic
909592725 1:77370087-77370109 CAGAATAAGTCCAAAGTGGCAGG + Intronic
910353389 1:86325679-86325701 CAGGATAATTAAAAAGTGCTTGG + Intergenic
911538912 1:99134747-99134769 AAGAATAAGTACAAGGTCTCTGG + Intergenic
912324452 1:108744767-108744789 CAGGAGAATGACCAGGTGCCAGG - Intergenic
912493596 1:110076896-110076918 CAGAACACTTACCATGTGCCAGG + Intergenic
912952693 1:114131217-114131239 CAGAGTAATTACTATGTACCAGG - Intronic
913447193 1:118962012-118962034 CAGAAGAACTACAAGAAGCCAGG + Intronic
914397158 1:147280812-147280834 CAAAATAACTACAAGATGCCAGG - Intronic
914783433 1:150806678-150806700 CAATATAACAACAAGGTGCCTGG - Exonic
915737125 1:158092066-158092088 GAGAATATTTACAAAATGCCTGG + Intronic
917150042 1:171933386-171933408 TTGAATGATTACTAGGTGCCAGG + Intronic
918121014 1:181540382-181540404 CTGAATAACTACTAAGTGCCAGG - Intronic
919628641 1:199937330-199937352 CAGAATATTTACCATGAGCCAGG - Intergenic
920907455 1:210184937-210184959 CAGAATATCTGCAAGCTGCCGGG - Intergenic
922645843 1:227285949-227285971 CAGAATGGTTTCAAGGGGCCAGG - Intronic
923523406 1:234753836-234753858 CAGAACAATTAAAAGGGGGCAGG - Intergenic
923765854 1:236891760-236891782 CAGAATGTATACCAGGTGCCAGG + Intronic
924303676 1:242665371-242665393 CTGAGTACTTACAATGTGCCAGG + Intergenic
924621085 1:245661281-245661303 CAAAATAATTAAAATGGGCCAGG - Intronic
1062776876 10:157894-157916 CAGAAAAACTGGAAGGTGCCCGG - Intronic
1063547604 10:6997587-6997609 CAGAAAAATTGCAAGGGGGCCGG + Intergenic
1064447741 10:15410907-15410929 CAGAATATTTAACAGTTGCCTGG + Intergenic
1067036245 10:42920992-42921014 CAGAATAATTAAAAGAGGCTGGG + Intergenic
1069415811 10:68199983-68200005 CAGAATGAGTAGGAGGTGCCAGG - Intronic
1071995841 10:91148476-91148498 CAAAATTAATACAAGGTGACTGG + Intergenic
1072236628 10:93459376-93459398 CAGAATCATCTCTAGGTGCCAGG + Intronic
1072431261 10:95373115-95373137 CAGATTTATTACAAAGAGCCTGG - Intronic
1073582139 10:104678358-104678380 CAGAACACTTACTATGTGCCAGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078965969 11:16343167-16343189 CAGAACAATTATAATTTGCCTGG - Intronic
1080121065 11:28678441-28678463 GAGAATATTTAGAAAGTGCCTGG - Intergenic
1083701687 11:64483503-64483525 CAGAACATTTGCAAGGTGGCAGG + Intergenic
1083875339 11:65520636-65520658 AAGAATAACTTCAAGCTGCCGGG - Intergenic
1086857427 11:91881858-91881880 CAGAAAAATTACATTGTACCTGG + Intergenic
1088483832 11:110321707-110321729 CAGAGTACTTACAATGTACCAGG - Intergenic
1090030515 11:123202239-123202261 CAGAAAAATCACAAGGTGTCTGG - Intergenic
1090413392 11:126524270-126524292 TAGACTACTTACAATGTGCCAGG - Intronic
1090776983 11:129974486-129974508 CAGAATAAGTAGAAGGTGAGGGG + Intronic
1092305702 12:7298554-7298576 CAGAATAAATACAAGCTTGCTGG - Intergenic
1095299722 12:40569549-40569571 CAGCATCATTACAAGGTAGCTGG - Intronic
1096212554 12:49777706-49777728 TATAATATTTACAATGTGCCAGG - Intergenic
1096600872 12:52728049-52728071 CAGAAAGATTACAATGAGCCAGG + Intergenic
1097720410 12:63013810-63013832 CATAATATTTACTATGTGCCAGG + Intergenic
1098476891 12:70915346-70915368 CAGAATTTTTACAAGGTGTTAGG + Intronic
1101844772 12:108354201-108354223 CATATTAAGTACATGGTGCCTGG + Intergenic
1102641897 12:114374199-114374221 CAGAACAACTACAAGGTAGCAGG + Intronic
1104567428 12:129897854-129897876 CAGAATTGTTACATGGTGCCAGG - Intronic
1106674155 13:31940009-31940031 CAGAATAATTCCAAGGTTTCTGG + Intergenic
1107272262 13:38633962-38633984 CAGAAAAAGTGCAAGGTGCTGGG - Intergenic
1108288701 13:48935544-48935566 CAGAATGATGACAGGGTGGCAGG - Intergenic
1109779676 13:67092814-67092836 CAGAAAAATAATAAGGTGCAAGG + Intronic
1110296259 13:73869682-73869704 AAGAGTAATTACAAGTTACCAGG - Intronic
1110584517 13:77172702-77172724 CAGAATGACTCCAAGGTGTCTGG + Intronic
1110620028 13:77584987-77585009 CAGAACACCTACTAGGTGCCAGG - Intronic
1115590061 14:34855736-34855758 CAGAAAAATTAAAAGGTAGCTGG + Intronic
1116322661 14:43490742-43490764 TAGAATATTTGCCAGGTGCCAGG - Intergenic
1117677333 14:58168087-58168109 CTGAACACTTACAAGGTGTCAGG + Intronic
1120182784 14:81362824-81362846 CTGTATAATTTCAATGTGCCAGG + Intronic
1120185192 14:81386705-81386727 CAGAAAAATTACCATGTCCCTGG + Intronic
1120244433 14:81990071-81990093 CTGAACAATTATAAGCTGCCTGG - Intergenic
1121069115 14:91000100-91000122 CAGAAAAATCTCTAGGTGCCCGG - Intronic
1122458470 14:101875936-101875958 CACAAAAACTACAAAGTGCCTGG - Intronic
1202937259 14_KI270725v1_random:101990-102012 CAGAATATTCACAATGTTCCAGG - Intergenic
1127301819 15:57662583-57662605 CAGAATGTATAGAAGGTGCCTGG + Intronic
1127613613 15:60661400-60661422 CATAATAATTACAAGGTCCCAGG - Intronic
1128100234 15:64992618-64992640 CAAAATAATTAAAAGCAGCCAGG + Intergenic
1128905077 15:71460283-71460305 GAGAAGAAATACAAGTTGCCTGG + Intronic
1131337952 15:91568077-91568099 CTCAATTATTCCAAGGTGCCAGG - Intergenic
1132065308 15:98726080-98726102 CTGAACAATGACTAGGTGCCAGG + Intronic
1133521993 16:6567661-6567683 CAGAATATCTACTGGGTGCCAGG - Intronic
1133525345 16:6599883-6599905 CAGAATATTTACTATGTGCAGGG - Intronic
1133999639 16:10772719-10772741 CAGAAAAATTAATAGGTGCCAGG + Intronic
1134501910 16:14775928-14775950 TAGAATAATTACAAAAGGCCAGG - Intronic
1134578651 16:15352966-15352988 TAGAATAATTACAAAAGGCCAGG + Intergenic
1134723937 16:16404579-16404601 TAGAATAATTACAAAAGGCCAGG - Intergenic
1137306732 16:47207925-47207947 CTGAATAATTACTATGTACCAGG + Intronic
1137995548 16:53206895-53206917 CAGACTACTTACTAAGTGCCAGG - Intronic
1139680172 16:68555293-68555315 CTAGATATTTACAAGGTGCCTGG - Intronic
1140016108 16:71187304-71187326 CAGAATAAATACAAGGTTACAGG + Intronic
1141193813 16:81844287-81844309 AAGAAAAATGAAAAGGTGCCCGG - Intronic
1141219413 16:82055309-82055331 CAGAATAGTGACTGGGTGCCAGG - Intronic
1143502233 17:7346281-7346303 CAGAAGAAGTACAAGGTGAGTGG + Exonic
1145187834 17:20810806-20810828 AAGAATTGTTACAAGTTGCCGGG - Intergenic
1149672312 17:58425415-58425437 AAAAAAAATTACAATGTGCCAGG + Intronic
1150079108 17:62220909-62220931 AAGAATTGTTACAAGTTGCCAGG + Intergenic
1151894673 17:76972062-76972084 CAGGATAATTACAAAATTCCAGG - Intergenic
1152030367 17:77838397-77838419 CAGAATGCTTTGAAGGTGCCAGG - Intergenic
1153694565 18:7627195-7627217 CAGAGTAATGACAGGGTGGCTGG - Intronic
1153891936 18:9525108-9525130 TAGACTATTTACAACGTGCCTGG - Intronic
1155820384 18:30368522-30368544 CAGAAAAATTGCAATTTGCCTGG + Intergenic
1156255425 18:35391282-35391304 CAGACTTCTTACATGGTGCCTGG + Intergenic
1157536745 18:48464798-48464820 GATAATATTTATAAGGTGCCAGG + Intergenic
1158915462 18:62122186-62122208 CAGAATAATTAAAAAGATCCTGG + Intronic
1159201604 18:65192781-65192803 CAGAATAGTTAAAATGTGGCAGG + Intergenic
1159288319 18:66382206-66382228 CACCAAAATTTCAAGGTGCCTGG - Intergenic
1159722362 18:71907594-71907616 CAGAATAATGACAAACTCCCAGG - Intergenic
1162345504 19:10115904-10115926 GGGGATAATTACGAGGTGCCGGG + Intronic
1163689900 19:18732793-18732815 CAGAATAACTACAGGAGGCCGGG + Intronic
1164505993 19:28861740-28861762 CAGAGTTATTAAAAAGTGCCAGG - Intergenic
1165903656 19:39180401-39180423 CAGAATAAATAAAAGGTTTCAGG + Intronic
1166770377 19:45278286-45278308 TAGGATGATTACAGGGTGCCAGG + Intronic
1168270681 19:55248057-55248079 CAGAGTATTAACAAGATGCCAGG + Intronic
929212796 2:39376551-39376573 CAGAATGAGTACTATGTGCCAGG + Intronic
929309665 2:40407729-40407751 CTGAATATTCACAAAGTGCCAGG - Intronic
931361331 2:61580385-61580407 CAGAATAATTATAAGGTCAAAGG - Intergenic
937939609 2:127274872-127274894 CTAAATACTTACAAGCTGCCAGG + Intronic
938755939 2:134378960-134378982 CATAATCATTACTATGTGCCAGG - Intronic
939675337 2:145065433-145065455 CAGAATAAATACCAGGAGACTGG + Intergenic
939695942 2:145324725-145324747 CATACTGCTTACAAGGTGCCAGG - Intergenic
939705159 2:145443623-145443645 AAGAAATATTACAAGCTGCCTGG + Intergenic
940725199 2:157328910-157328932 AAGAATAATAACTAGGGGCCAGG - Intergenic
941137050 2:161731126-161731148 CAGAATACCTACCATGTGCCAGG - Intronic
942720305 2:178944286-178944308 CTGAATAGTTACTATGTGCCAGG - Intronic
942950505 2:181715859-181715881 TAGAATAATTACAAGCTGAGAGG - Intergenic
944132633 2:196363228-196363250 CAGAATGGTTACTATGTGCCAGG + Intronic
944945699 2:204682152-204682174 CAGAATAATGGCAACTTGCCTGG + Intronic
945065324 2:205943331-205943353 CTGAAAAGTTACAAGGTGCAGGG + Intergenic
946723862 2:222641656-222641678 CATAAAAATCACAAGGTGACTGG + Intronic
947634165 2:231671776-231671798 CAGAAAAATTACATGCTGGCTGG - Intergenic
948330419 2:237160367-237160389 CAGAGGCCTTACAAGGTGCCGGG + Intergenic
948583427 2:239003512-239003534 CAAAAAAATTACAAAGAGCCGGG + Intergenic
1168837861 20:889899-889921 CAGAGGACTTACAATGTGCCAGG - Intronic
1168940347 20:1706258-1706280 CAGAAAAATTAGAAAGTGCAGGG - Intergenic
1170007996 20:11689738-11689760 CAGAATAATTCCCAGGTTTCTGG - Intergenic
1170339677 20:15310154-15310176 GGGAATATTTATAAGGTGCCTGG + Intronic
1171234379 20:23512497-23512519 CAGAATCATCACCAGGTGACAGG + Intergenic
1172233705 20:33354825-33354847 CAAAATAATCACAAGGTTCTTGG + Intergenic
1172556152 20:35843172-35843194 CAGAAGATCTACAATGTGCCAGG - Intronic
1173483163 20:43419340-43419362 AAGAATAATTAAAAAGTGGCTGG + Intergenic
1173518412 20:43681647-43681669 GTGAATACGTACAAGGTGCCAGG - Intronic
1174903883 20:54529482-54529504 CAAAATAATTACAGAATGCCTGG - Intronic
1178192133 21:30296080-30296102 GAGAATAACTACTATGTGCCTGG - Intergenic
1179176096 21:39009370-39009392 CAGAATTACGACAAGGTGTCTGG + Intergenic
1181618991 22:24074963-24074985 CAGAAAGATTACATGGGGCCAGG + Intronic
1183884813 22:40870721-40870743 AAGAAAAATTAAAAGGGGCCGGG + Intronic
1184368345 22:44067135-44067157 CAGAATAAATTAAAGGGGCCTGG - Intronic
949443242 3:4106379-4106401 GATAATGATTGCAAGGTGCCTGG - Intronic
951814355 3:26736900-26736922 TTGAATACTTACAATGTGCCAGG - Intergenic
955004063 3:54953138-54953160 CTGAATATTTACTATGTGCCTGG + Intronic
958505439 3:94971560-94971582 TAGAATAACTACAAGATGTCTGG - Intergenic
958988316 3:100809948-100809970 CTGAATAACTACAAGGTGACTGG + Intronic
959967490 3:112373352-112373374 CAGAAGAATTACAATTTGGCTGG - Intergenic
961990478 3:131184620-131184642 CAGTAGAATAACAAGTTGCCAGG + Intronic
962196310 3:133366695-133366717 GAGAATAATTAAAAGGTGGAGGG + Intronic
962910988 3:139849300-139849322 CTGAACAATTACCAAGTGCCTGG - Intergenic
966458586 3:180147306-180147328 CATAGGAATTACTAGGTGCCAGG - Intergenic
966738569 3:183210911-183210933 CAGCATAAAAACAATGTGCCAGG + Intronic
968209671 3:196838317-196838339 AAGAATTATTACAGGGAGCCAGG - Intergenic
970743117 4:19261502-19261524 TTGAATAATTCCAAGGTGCCAGG - Intergenic
971254944 4:25005840-25005862 CAGAAAGCTTACAAGGTGCGGGG - Intronic
972234618 4:37116624-37116646 TTGAATAATTACAATGTGCCAGG - Intergenic
974463608 4:62223524-62223546 CAGTATAATTATAAGGAACCAGG + Intergenic
974802573 4:66837450-66837472 CAGAATAATTACAGAATTCCAGG - Intergenic
974909957 4:68105416-68105438 CAAAATAAATACAAGTTGACTGG + Intronic
975157073 4:71083879-71083901 CAGAATGCTTACCATGTGCCAGG - Intergenic
975428720 4:74261681-74261703 AATAATAATTACAAGTTGCTAGG - Intronic
976493825 4:85703156-85703178 TAGAATAATTAAAAGTTGCCTGG + Intronic
976512925 4:85931434-85931456 CAGAATCAAAACAAGGTGACGGG - Intronic
977373997 4:96177157-96177179 CTGAATATTTACATTGTGCCAGG + Intergenic
977594222 4:98860589-98860611 TATAATACTTACAATGTGCCAGG + Intergenic
977920265 4:102635314-102635336 CAGAAAAATTACAACGCACCAGG - Intronic
979169364 4:117581191-117581213 GAAAATAATTAGAAGGTGCTGGG + Intergenic
979499665 4:121425269-121425291 CATAATAATTATTAGGTACCAGG - Intergenic
980034787 4:127871432-127871454 ATGAATATTTACAATGTGCCAGG - Intergenic
980788537 4:137587335-137587357 CAGAATAATAACTAGCTGACAGG - Intergenic
981697864 4:147576789-147576811 ATGAATAATTGCAAAGTGCCTGG - Intergenic
984055076 4:174918246-174918268 CTGAATAACTATCAGGTGCCGGG + Intronic
984201101 4:176722461-176722483 GAAAAAAATTACAAGGGGCCAGG - Intronic
985129994 4:186729372-186729394 TAAAATAATTCCAAGGTGCAGGG - Intergenic
986022529 5:3818362-3818384 CAGAGTATTTCCAAGGTGGCTGG + Intergenic
986630938 5:9773036-9773058 CAGAAAAATAACAAAGTGGCAGG - Intergenic
993765534 5:91852209-91852231 ACGAAGAATTACAATGTGCCTGG - Intergenic
995190085 5:109310496-109310518 CTGAGTATTTACAATGTGCCAGG + Intergenic
995569325 5:113462795-113462817 CTGAATAGTAACAATGTGCCAGG + Intronic
995872920 5:116761376-116761398 CAGAATATTTACTATGTGCCAGG + Intergenic
997692556 5:135836407-135836429 TTGAATACTTACTAGGTGCCAGG + Intronic
998288623 5:140889869-140889891 CAGAATTCTTACATGGTGGCAGG - Intronic
1000168726 5:158680518-158680540 CACAATATTTACTAGGTGCTAGG - Intergenic
1000923646 5:167167790-167167812 CTGAATACTTACAAAGTGCCAGG - Intergenic
1001338657 5:170823686-170823708 TAGAAAAATAACAAGATGCCGGG + Intergenic
1002053527 5:176585432-176585454 AAAAATTCTTACAAGGTGCCTGG - Intronic
1005213996 6:23503629-23503651 CAAAATAATTACAATAGGCCAGG + Intergenic
1005287125 6:24339720-24339742 CAGAGTAATTACATGGTGCCTGG + Intronic
1007452933 6:41953891-41953913 CTGAATACTTACTATGTGCCAGG + Intronic
1008586460 6:52955062-52955084 AAGAGTAAGTACAAGGTGGCCGG + Intergenic
1010250538 6:73702615-73702637 CAGCATAATCACGATGTGCCTGG + Intronic
1010318724 6:74481935-74481957 CTGAATAATTATAAAGTGTCAGG + Intergenic
1010709927 6:79162015-79162037 CAGGCCAATTACAAGGTGTCAGG - Intergenic
1011987447 6:93466551-93466573 CTGAATTATTACAAAGAGCCAGG + Intergenic
1012999522 6:106008545-106008567 CTGAATATTTACTAAGTGCCTGG + Intergenic
1013164702 6:107579226-107579248 CGGAATAATCAGAAGCTGCCTGG + Intronic
1014894095 6:126879938-126879960 GAGAATTATATCAAGGTGCCTGG - Intergenic
1014942224 6:127456198-127456220 CAGACTAATTTCAAGCTACCTGG + Intronic
1018459050 6:163980178-163980200 CAGAATAATTACATGACCCCGGG - Intergenic
1021902036 7:25295315-25295337 AAAAATAATTACAAGGTGCAAGG - Intergenic
1022648956 7:32257578-32257600 CAGAATAATTACAAGGTGCCAGG - Intronic
1022800350 7:33771039-33771061 CAGACTCTTTACAAGGTGGCAGG - Intergenic
1023330969 7:39116444-39116466 TTGAATGTTTACAAGGTGCCAGG + Intronic
1026387364 7:69863617-69863639 CAGAATAATTACTGGGGGCATGG - Intronic
1028839936 7:95418258-95418280 CAGGGTATTTACAAGGAGCCTGG - Intronic
1029614021 7:101645061-101645083 CGGAATCCTTAGAAGGTGCCGGG - Intergenic
1029855827 7:103515832-103515854 CAGAGTGAAAACAAGGTGCCAGG - Intronic
1031315766 7:120256100-120256122 CAGAAAACTTACAAGTGGCCAGG - Intergenic
1031415738 7:121494742-121494764 CTGAATGATTACTATGTGCCAGG + Intergenic
1031765167 7:125769104-125769126 TAGAATAATTACAAAATGCTGGG - Intergenic
1032597993 7:133261532-133261554 CTCAAAAACTACAAGGTGCCCGG - Intronic
1033558938 7:142512581-142512603 CAGAAAACTTCCAAGGTGACAGG - Intergenic
1033851787 7:145505089-145505111 CAGAATAAAAACAATGGGCCAGG - Intergenic
1038019985 8:23544715-23544737 CAGCCTATTTCCAAGGTGCCTGG + Intronic
1038268975 8:26060058-26060080 AAGAATAATAACAATATGCCTGG + Intergenic
1039916046 8:41861054-41861076 CAGAAGAATCAACAGGTGCCAGG + Intronic
1040700948 8:50064760-50064782 CAGAATTATAAGAAGGAGCCAGG - Intronic
1041706347 8:60850221-60850243 CAGAATAACTGCAAGATGCCTGG - Intronic
1042117323 8:65446385-65446407 CATAAAACTTACAAAGTGCCTGG - Intergenic
1043334816 8:79162379-79162401 CAAAATAATTACAAGGTGGTTGG - Intergenic
1044501179 8:92959865-92959887 CACAAGAATTACAAACTGCCTGG + Intronic
1044689650 8:94864134-94864156 CAGAATAGTCACAATGTGTCAGG + Intronic
1045029105 8:98117855-98117877 CAGAATACTTACAAGGGATCTGG - Intronic
1045183243 8:99809554-99809576 CTGAATAATTAAGAGGTGTCTGG - Intronic
1045458812 8:102409181-102409203 CAGAATGATTACAAGGTGCCTGG - Intronic
1046042773 8:108927046-108927068 CAACAAACTTACAAGGTGCCAGG + Intergenic
1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG + Intergenic
1050752115 9:8951635-8951657 CAGAATAATTTAAAGGTTTCTGG - Intronic
1051091043 9:13408541-13408563 CTGAATACCTACAAAGTGCCAGG - Intergenic
1051426978 9:16942034-16942056 AAGAATAATCACAATGGGCCAGG + Intergenic
1053375212 9:37600374-37600396 CAGAATAAATAGGAGGTGGCCGG - Intronic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1058501452 9:105622752-105622774 CACAATACTTACAATGTGCCAGG - Intronic
1059983264 9:119796528-119796550 CAGAATAGTTAAAAGGTCTCAGG + Intergenic
1060190207 9:121587926-121587948 CAGATGAAATACAAGATGCCAGG - Intronic
1062241768 9:135544782-135544804 AAAAAGAAATACAAGGTGCCTGG + Intergenic
1062455515 9:136635517-136635539 CAGAATAAATATAAGGTCACTGG - Intergenic
1187364542 X:18655743-18655765 CTGATTAATTACAAGGGGGCTGG + Intronic
1187395403 X:18915042-18915064 TAGAATAATAACAAATTGCCAGG + Intronic
1190336203 X:49263918-49263940 CAGGAGGATTGCAAGGTGCCGGG - Intronic
1195749642 X:108150988-108151010 TAGAATGCTTACAATGTGCCAGG - Intronic
1197019001 X:121663713-121663735 GATAATAATTACTATGTGCCAGG + Intergenic
1197643500 X:128992819-128992841 CAGAATGATTCCCAGGTTCCTGG + Intergenic
1198452768 X:136784376-136784398 CAGAAATATTTCAAGGTCCCAGG - Intergenic
1201345132 Y:12975318-12975340 TAGAAAAATTAAAAGGTGCCAGG + Intergenic
1201465547 Y:14276333-14276355 CAGGATAATTACATGGAACCAGG + Intergenic