ID: 1022649820

View in Genome Browser
Species Human (GRCh38)
Location 7:32264459-32264481
Sequence TTTTTAAGTCAGATGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022649820_1022649824 9 Left 1022649820 7:32264459-32264481 CCTAGTTCCATCTGACTTAAAAA 0: 1
1: 0
2: 4
3: 43
4: 325
Right 1022649824 7:32264491-32264513 TTTACACTCTGCTATTTTCATGG No data
1022649820_1022649825 20 Left 1022649820 7:32264459-32264481 CCTAGTTCCATCTGACTTAAAAA 0: 1
1: 0
2: 4
3: 43
4: 325
Right 1022649825 7:32264502-32264524 CTATTTTCATGGCTAGCTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022649820 Original CRISPR TTTTTAAGTCAGATGGAACT AGG (reversed) Intronic
900782610 1:4627889-4627911 TCTGCAATTCAGATGGAACTGGG - Intergenic
902792900 1:18781167-18781189 TTTTGGAGTCAGATAGATCTAGG + Intergenic
903242004 1:21989191-21989213 TTCTGGAGTCAGATGAAACTGGG - Intronic
903245512 1:22012379-22012401 TTCTGGAGTCAGATGAAACTGGG - Intronic
904481291 1:30795292-30795314 TTTTGGAGTCAGATAGATCTGGG + Intergenic
904787571 1:32994164-32994186 TTTTCTAGTCAGATAGAACAGGG + Intergenic
905136395 1:35803849-35803871 TTTTCAAATCAGATGGTCCTGGG - Intergenic
906830021 1:49021149-49021171 TTTTGAAGTCAGACGGATCTGGG + Intronic
907668793 1:56456581-56456603 CTTTGAAGTCAGATAGATCTAGG - Intergenic
908068328 1:60432150-60432172 TTTTTAAGTCAGTTTGTATTGGG - Intergenic
908991895 1:70101754-70101776 TTTTTAAATGAGGTGGAAATAGG + Intronic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
909531745 1:76689836-76689858 TTTTTAAATCAGAGAGAACTGGG - Intergenic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
910586923 1:88890972-88890994 TTGGTAAGCCAGATGGAACCTGG - Intronic
910592771 1:88945210-88945232 TTTTTTAGTCAGAAGGAATTTGG + Intronic
912844635 1:113068533-113068555 TTTTTAAGTAATCTGGAGCTGGG + Intergenic
914427749 1:147594003-147594025 TTTTAGAGTCATATGGACCTGGG - Intronic
915340805 1:155175636-155175658 TGCTTAAGTCAGGTGGGACTGGG + Exonic
916003203 1:160636008-160636030 TTTTGAAGTCAGACAGACCTAGG - Intronic
916363508 1:163997885-163997907 TTTTAAAGTCAGATGGGCCTGGG + Intergenic
916678638 1:167085115-167085137 TTTATAAGTCAGCTGGGAATGGG + Intronic
918146499 1:181760759-181760781 CTTTGAAGTCAGATAGAACAGGG - Intronic
918198262 1:182242923-182242945 GCCTTAAGTCAAATGGAACTTGG + Intergenic
918586606 1:186195510-186195532 TTTTGTAGTCAGATGGACTTGGG - Intergenic
919260371 1:195185411-195185433 TTTTTAAGTCAGGTATGACTGGG - Intergenic
919776405 1:201196960-201196982 TTTTGGGGTCAGATGGATCTGGG - Intronic
919840468 1:201605598-201605620 TTGTTTAGACAGATGGGACTGGG + Intergenic
920078435 1:203354052-203354074 TTTTAAAGTGAGATGGGGCTGGG + Intergenic
920081761 1:203379891-203379913 TATTTATTTCAGCTGGAACTCGG + Intergenic
921008031 1:211113237-211113259 TTTTGAAGTCACATAGACCTAGG - Intronic
921052698 1:211522460-211522482 TTTTCAAGTCAGATTAAACCTGG - Intergenic
922007673 1:221548743-221548765 TTTTGGATTCAGATGGACCTGGG - Intergenic
922852363 1:228744306-228744328 TTTTTAAATCATAAGTAACTGGG - Exonic
923154204 1:231262293-231262315 TTTTTAAGTCAGACTGACTTGGG + Intronic
923643016 1:235784789-235784811 TAGTTAAATCAGATGGAGCTGGG - Intronic
924854243 1:247859653-247859675 TTATTAGGTCAGAAGGAACTTGG - Intronic
1063002885 10:1941157-1941179 TTTTTAAGTCAGGCGGAGGTGGG + Intergenic
1063994572 10:11607351-11607373 TTTATAAGTCAGTTGGCTCTAGG - Intronic
1064667283 10:17668041-17668063 TTATTAACTCCGATGGACCTTGG - Intronic
1065249132 10:23792810-23792832 TTTTAAAGTAAGATTGAACGTGG + Intronic
1065323639 10:24531731-24531753 TTTTTAAATCAGATTGCATTGGG + Intronic
1065591079 10:27262400-27262422 TTTATAACTCAGAAGGCACTTGG + Intergenic
1065659955 10:27995713-27995735 TTTTTAACTCAGAATGCACTTGG - Intronic
1065715942 10:28568305-28568327 TTTTTAAGTCAATTGGAAATAGG + Intronic
1066660290 10:37732175-37732197 TTTCTAAATCAGATGAAACTTGG - Intergenic
1067715726 10:48689962-48689984 CTTTAAAATCAGGTGGAACTAGG - Intronic
1069275362 10:66585008-66585030 CTTATAAGCCAGATGGAATTGGG - Intronic
1069534704 10:69244499-69244521 ATTTTAAGTAAAATGGAAATGGG - Intronic
1070614493 10:77958932-77958954 TTTTAGAGTCAGATGGAGCAGGG + Intergenic
1071743690 10:88390897-88390919 TTTTTATGTAAGATTGAATTTGG - Intronic
1071852012 10:89582667-89582689 TTTTAAAGCCAGATAGAAGTTGG + Exonic
1072030068 10:91510844-91510866 TTTTTAAGTCAGACTGATCTGGG + Intronic
1072810026 10:98454378-98454400 GATTTAAGTCATATGGAACTTGG + Intergenic
1074852023 10:117446711-117446733 TTTTCAAGTCAGATTGAATTGGG - Intergenic
1075179190 10:120195308-120195330 TTTTTAAGTTTGGTGGAACTTGG + Intergenic
1079151370 11:17902639-17902661 TTTTTTAGTTAGGTGGAACATGG + Intronic
1079191331 11:18279328-18279350 TATTTAAGTAAAATGGGACTGGG - Exonic
1079324201 11:19477499-19477521 TTTTGCATTCAGACGGAACTGGG + Intronic
1080936922 11:36873485-36873507 TTTTGAAGTCACAGGGATCTAGG + Intergenic
1081111191 11:39136070-39136092 CTTATAAGCCAGAAGGAACTGGG - Intergenic
1081321026 11:41691742-41691764 TCTTTAAATGAGATGGACCTAGG + Intergenic
1081438031 11:43049687-43049709 TTTTAAAGTTAAATGGACCTAGG - Intergenic
1085584921 11:77692986-77693008 TTTTTAAGGCAAATGAAAGTAGG + Intronic
1086357431 11:86018125-86018147 TTTTTTAGTCAGATGAATCTAGG - Intronic
1086532661 11:87804022-87804044 TTTTTCACTCTGATGCAACTTGG + Intergenic
1086954132 11:92918014-92918036 CTTTCAAGTCAGATAGACCTAGG + Intergenic
1087820020 11:102701283-102701305 TTTTTAAGTCCGATGTATCTGGG - Intronic
1087892193 11:103547977-103547999 GTTTTAAGTCAGATGGACGTGGG + Intergenic
1089370805 11:117955098-117955120 TTTTGAACTCAAATGGATCTGGG + Intergenic
1089933402 11:122337891-122337913 TTTTTAACTCATATGGTATTTGG + Intergenic
1090102632 11:123816357-123816379 TTTTGAAGTCAGATAGTTCTTGG + Intergenic
1090158273 11:124464472-124464494 ATTTTAAATCATATGGATCTTGG + Intergenic
1091546981 12:1507775-1507797 TTTTTCAATCAGAGGGAAGTTGG - Intergenic
1091904805 12:4176191-4176213 TTATTGAGTCAGAAGGAACTAGG - Intergenic
1093096242 12:14975336-14975358 TTTGTAATTCAAATTGAACTGGG + Intronic
1093772515 12:23034034-23034056 TCTGAAAGTCAGATGTAACTGGG - Intergenic
1093939722 12:25039983-25040005 TTCTGAAGTCAGACAGAACTAGG - Intronic
1094365821 12:29679953-29679975 TTTTTAAGTTATATAGTACTAGG - Intronic
1096008020 12:48187701-48187723 TTTTTAAGTCAGACAGATCTGGG - Intergenic
1096553417 12:52389032-52389054 TTTTAGAGTCAGATGGACCTGGG + Intergenic
1097240430 12:57571461-57571483 TTTTAAAATCAGATGGAAGAAGG + Intronic
1097303562 12:58043986-58044008 GTTTTAAGGCAGATGAAACAGGG + Intergenic
1098414858 12:70221290-70221312 CTTTGAAGTCAGAAAGAACTGGG + Intergenic
1098562767 12:71895276-71895298 TTTTTAAGTAAGATGGGTTTTGG + Intronic
1098763624 12:74456637-74456659 TTTAGAAGTCAGATTCAACTTGG - Intergenic
1099019036 12:77380716-77380738 CTTTGGAGTCAGATGTAACTTGG + Intergenic
1099390619 12:82074418-82074440 TTTTTAACTGACATGTAACTGGG - Intergenic
1099428801 12:82555808-82555830 TTTCTAAGTCAAAGGGAACATGG - Intergenic
1099709095 12:86196954-86196976 TTTTTAAGCAAGATGGAACCAGG - Intronic
1099927846 12:89039904-89039926 AATTTAAGCCAGATGGAATTTGG + Intergenic
1100157321 12:91815868-91815890 TTCTGGAGTCAGATGAAACTGGG - Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1101133683 12:101716301-101716323 TTTTTAAGTGAAATTGACCTGGG + Intronic
1101654114 12:106705029-106705051 GTTGTAAGTCAGATAGACCTGGG + Intronic
1101699750 12:107161373-107161395 TTTTTGAGTCAGATAGAATTGGG + Intergenic
1102472101 12:113165106-113165128 TTTTGAAGTCAAATGGACTTGGG - Intronic
1102715010 12:114962994-114963016 CTTTGGAGTCAGATGGACCTGGG - Intergenic
1103337342 12:120199597-120199619 TTTTGAAGTCAGAGGGAGATTGG + Intronic
1105561502 13:21496724-21496746 TTTTGAAGTCAGATGGACCAAGG - Intronic
1106118097 13:26834156-26834178 CTTTAAAGTCAGATGGACCCTGG + Intergenic
1106597042 13:31153179-31153201 TTTTTATTTCAGCTTGAACTTGG - Intronic
1106876557 13:34080451-34080473 TTTTTTAGTCACATGAAATTAGG + Intergenic
1107068955 13:36248885-36248907 TTTTTAAGTCACATGGACTGTGG - Intronic
1107873717 13:44770569-44770591 TTTTTAAGTCAAATGTCTCTGGG - Intergenic
1109416554 13:62047729-62047751 CTTTGGAGTCAGATGGAATTGGG + Intergenic
1109729604 13:66394613-66394635 TATTTAAATGAGATGGAAGTTGG - Intronic
1110648795 13:77919187-77919209 TTCTCAAGTCAGCAGGAACTTGG + Intronic
1110959476 13:81603279-81603301 TATTTAAGTAAAATGGAATTTGG + Intergenic
1111175069 13:84583849-84583871 TTTTTAAGTCAGACAGATTTGGG - Intergenic
1111470957 13:88681959-88681981 TTCTTAAAACAGATGGATCTTGG - Intergenic
1115430509 14:33312502-33312524 TTTTTAATTCAAATGGTAATTGG - Intronic
1115965949 14:38888364-38888386 TTTTGGAGGCAGATGGACCTGGG - Intergenic
1116354547 14:43912348-43912370 TTTTTGTTTCAGAGGGAACTTGG - Intergenic
1116500121 14:45610773-45610795 TTTTTCAAGCAGATGCAACTGGG - Intergenic
1118639887 14:67782563-67782585 GTTTAAAGTCAGATGGACTTGGG + Intronic
1119549666 14:75499320-75499342 TTTTTAAGTCAACTGGAACCTGG + Intergenic
1119571177 14:75674222-75674244 TTATTAAGCCACAAGGAACTGGG - Intronic
1119603417 14:75993490-75993512 TTTTCAATTCAGACGGAAATGGG - Intronic
1119925987 14:78494288-78494310 TCTTTAATTCAAATGGAATTAGG + Intronic
1119994866 14:79242203-79242225 TTTTGTAGTCAGATAGACCTGGG - Intronic
1120033695 14:79671230-79671252 CTCTTAAGTCAGATGGTTCTGGG - Intronic
1122369299 14:101220225-101220247 TTCTGAATTGAGATGGAACTGGG - Intergenic
1125059040 15:35396927-35396949 TTTTTAAGTAATAGGTAACTGGG + Intronic
1127562902 15:60158098-60158120 TTTTGAAGTCAGAGGGACCCAGG + Intergenic
1128661334 15:69503135-69503157 TTTGTAAGTCAGAAAGAACCGGG + Intergenic
1128759632 15:70207358-70207380 CTATGAAGTCAGATGGATCTGGG + Intergenic
1129618963 15:77125674-77125696 CTTTTAAGTCAGACAGACCTGGG - Intronic
1129640839 15:77376330-77376352 TATTTATGTGAGAAGGAACTTGG - Intronic
1129994493 15:79992843-79992865 TTTTGGAGTCAGATGGCCCTGGG - Intergenic
1130209666 15:81911555-81911577 TTTTGAAGACAGTTGGCACTGGG + Intergenic
1130457200 15:84122977-84122999 TTTTTTAATCAGTTGGAATTAGG - Intergenic
1131614430 15:93999850-93999872 TCTTTAAGTCAGTTGTCACTTGG + Intergenic
1132040831 15:98523498-98523520 TTTTGAAATCAGATAGACCTGGG - Intergenic
1132054715 15:98641582-98641604 CTTTTCAGTCTGTTGGAACTGGG + Intergenic
1133605377 16:7382047-7382069 TTTATAAATCAGTTGGAAGTTGG + Intronic
1133624605 16:7559461-7559483 TTTTTAAGGCAGATGGGGTTGGG - Intronic
1136021757 16:27445029-27445051 TCTTGAAGTGAGATGGATCTGGG - Intronic
1136225831 16:28859892-28859914 TGTTTAAGTTAGCTGGAATTAGG + Intronic
1137576807 16:49605306-49605328 TTATTGAATGAGATGGAACTTGG + Intronic
1137741877 16:50784962-50784984 TTTTTAAGGCAGGTGGAAAGAGG - Intronic
1139721777 16:68861898-68861920 CTTTTAATTCATTTGGAACTTGG - Intronic
1140258082 16:73354104-73354126 TTTGGAATTCAGATTGAACTGGG - Intergenic
1141683643 16:85557760-85557782 TTTTTAAGTCAGTTGGACTCTGG - Intergenic
1143854341 17:9837576-9837598 TTTTTAACTCCCATGGGACTTGG + Intronic
1146018828 17:29257000-29257022 CTTTTTTGTCATATGGAACTTGG - Exonic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148198749 17:45733811-45733833 TTATTAACTCAGATAGAAATAGG + Intergenic
1150068010 17:62127745-62127767 TTTGTAAGACAGAAGGAACCCGG + Intergenic
1150816014 17:68392344-68392366 TTTTTAAGTCATATGGTGCAAGG - Intronic
1151444835 17:74156418-74156440 TTTTTAAAGCAGACGGAATTTGG - Intergenic
1151773512 17:76181106-76181128 TTTTGGAGTCAGATGTACCTGGG - Intronic
1154093740 18:11390174-11390196 TCTTCAAGTCAGAGAGAACTTGG - Intergenic
1155111387 18:22718139-22718161 TTTTGAAGTCACATAGACCTCGG - Intergenic
1156516397 18:37684160-37684182 TCTTTAAGTCAGCTGGAACAAGG + Intergenic
1157619004 18:49004506-49004528 TTTTTAGTACAGATGGAATTTGG - Intergenic
1157704989 18:49798684-49798706 TTTTGAATGCAGATGGAACTGGG + Intronic
1158431396 18:57390363-57390385 GTTCTAAGTCATCTGGAACTGGG - Intergenic
1159568826 18:70088793-70088815 TTTTTTAGTCACATTGAACTTGG - Intronic
1163552495 19:17973595-17973617 TTTTTCAGTGAGATGGCACTGGG + Intronic
1165209107 19:34218316-34218338 TTTTTAAGACAGAAGGATCATGG + Intronic
1166394279 19:42427298-42427320 TTTTTAAGGCAGCTGGCAGTTGG + Exonic
925237859 2:2294683-2294705 TATCTAAGTCACATGTAACTAGG + Intronic
925545723 2:5013730-5013752 TCTTGAAATCAGAAGGAACTGGG + Intergenic
926646898 2:15299791-15299813 TTTTTTAGACAGATGTAAGTAGG - Intronic
927759052 2:25734705-25734727 CTGTTAAGTGAAATGGAACTTGG - Intronic
928908492 2:36393963-36393985 TTTTTGAGGAAGATGGATCTGGG + Intronic
930677713 2:54222180-54222202 TTTTGGAGTCAGATGGACTTGGG - Intronic
931270109 2:60694042-60694064 TGCTTAAGTAAGAGGGAACTGGG - Intergenic
931804790 2:65793842-65793864 TGTTTAAGTCGGTTAGAACTGGG - Intergenic
933247073 2:79987380-79987402 TTTTGAATTCAGAAAGAACTGGG + Intronic
933478506 2:82822674-82822696 TTTTTAAGACAGATCTCACTAGG - Intergenic
935197157 2:100823933-100823955 TTTTGAAGTCAGACAGACCTGGG + Intronic
935515466 2:104031331-104031353 TTTATAACCCAGATGTAACTTGG - Intergenic
935790133 2:106583438-106583460 TTTTTATGTCATAAGGAAATTGG + Intergenic
936239924 2:110778522-110778544 TTTTGGAGTCAGATAGAACAGGG + Intronic
936759037 2:115751754-115751776 TTTCTAAGTCATATAAAACTGGG + Intronic
937632192 2:124115550-124115572 TTCTGAAGTCAGATAGACCTGGG + Intronic
938387831 2:130880313-130880335 TTTTTCAGGCAGATGGACATGGG - Intronic
938859556 2:135353618-135353640 TTTTTAATTTAGATGGGTCTAGG - Exonic
939494498 2:142912137-142912159 TTTGTAAGTCTGATAGAATTTGG + Intronic
941065218 2:160893991-160894013 TTTTCAAGTCAAATTGACCTCGG + Intergenic
941678171 2:168366415-168366437 GTTTAAAGTCAGATTTAACTGGG - Intergenic
941821626 2:169849647-169849669 CTGTTAAGTCAGATAGAATTTGG + Intronic
942438808 2:176009925-176009947 TATATAAGGCAGATGGTACTTGG + Intergenic
943966486 2:194340593-194340615 TATTTTAGTCAGAATGAACTAGG - Intergenic
944734814 2:202552354-202552376 GTTTTGAGTTTGATGGAACTTGG - Intronic
947546986 2:231017174-231017196 TGTCTAAGCCAGATGGAGCTAGG - Intronic
948329218 2:237151737-237151759 TTTCTCAGTCAGATGCAACATGG + Intergenic
1172043435 20:32062295-32062317 ATTTGAAGTCAGATAGAGCTGGG - Intronic
1172189805 20:33055073-33055095 TTTTTATGTCAGATGGACTCAGG + Intergenic
1173311481 20:41899966-41899988 TTTTAAAGTCAGATTCAACCAGG - Intergenic
1174363724 20:50043940-50043962 ATTTTAAGAAAGAGGGAACTGGG + Intergenic
1174459183 20:50670810-50670832 GTTTTAAGTCAGATCCGACTGGG + Intronic
1174651103 20:52126352-52126374 TTCTGAAGTCAGAAAGAACTGGG - Intronic
1175279809 20:57795412-57795434 TTTTTGAGTGAGATGGGCCTGGG + Intergenic
1176938989 21:14900879-14900901 TTTTTAAGTCATAAGGAAGAAGG - Intergenic
1181893517 22:26085806-26085828 TTTTAAAGGCACATGGAGCTGGG - Intergenic
1182291666 22:29284724-29284746 TTTTAAAGTCCGATTAAACTAGG - Intronic
1182335045 22:29578470-29578492 CTTTGAAATCAGATGGACCTGGG - Intronic
1183080114 22:35450812-35450834 TTTTGGAGTCAGATGGACCCGGG - Intergenic
1184307036 22:43611499-43611521 TTTTAAATTCATATGGGACTAGG + Intronic
1184839077 22:47042080-47042102 TTTTTATAGAAGATGGAACTGGG + Intronic
949363475 3:3255926-3255948 TTTTAAAGTCAGATGACACTGGG + Intergenic
949977331 3:9473025-9473047 TATTTAAGGCAGCTGGAAATTGG - Intronic
949977439 3:9473868-9473890 TTGTTAATTCATGTGGAACTTGG - Intronic
951397217 3:22183759-22183781 TTTATAATTAAAATGGAACTTGG + Intronic
951403601 3:22265924-22265946 TTTTAGAGTCGTATGGAACTGGG - Intronic
953597628 3:44333328-44333350 TTCTTTAGTAAGAAGGAACTGGG + Intergenic
955397914 3:58569947-58569969 TTTTCATGTCAGATGGACCTTGG + Intronic
955492689 3:59499035-59499057 TTTTGAATTCTGATGGAACGTGG + Intergenic
955676824 3:61457551-61457573 TTTTAAAATCAGACTGAACTGGG - Intergenic
957772598 3:84713639-84713661 TTTTTAAGTCTGATAGAATTAGG - Intergenic
959322066 3:104889180-104889202 TTTTTTATTCAGAGGAAACTGGG - Intergenic
959808661 3:110590975-110590997 TTTATAAGTTATATGGACCTAGG - Intergenic
959895298 3:111598903-111598925 TATTGAAGACAGATTGAACTTGG - Intronic
960379440 3:116941061-116941083 TTTATAAGCCAGAAGGAACTGGG + Intronic
960769716 3:121180251-121180273 TTTACAAGCCAGAAGGAACTGGG + Intronic
961338110 3:126197260-126197282 TGTATAAGCCAGAAGGAACTTGG + Intronic
962763362 3:138538738-138538760 TTTTTAAGTCATCTGGTTCTGGG + Intronic
967693292 3:192502294-192502316 TTTTTAAGTCTGCTTAAACTTGG - Intronic
967772295 3:193347416-193347438 TTTTAGAGTCAGATGAACCTAGG - Intronic
968246917 3:197160118-197160140 TTTTAAAGTCAGAATGACCTGGG - Intronic
969383908 4:6830068-6830090 TGTTTAAGCCAGATTGAGCTGGG - Intronic
970216911 4:13768718-13768740 TTTTTATGTCAGAGGGAAGTAGG - Intergenic
970226878 4:13868060-13868082 TTTTCAAGTCAGATAGAACTGGG - Intergenic
970252604 4:14131749-14131771 TTTTTGAGCCAGAAGGAACCTGG - Intergenic
973034505 4:45389534-45389556 TTTTTATTTCAGATTGACCTTGG + Intergenic
973281712 4:48365133-48365155 TTTTTAAGTGAGACTGACCTAGG - Intronic
973342876 4:49024254-49024276 TTTTGAAGACAGCAGGAACTTGG + Intronic
975198541 4:71556120-71556142 TTTTAAAGTCAGATAGAACTGGG + Intronic
975378520 4:73671866-73671888 CTTTTGAGTCAGATGTATCTGGG + Intergenic
975499124 4:75065742-75065764 TTTGAAAGTCAGAAGGAAGTAGG - Intergenic
975648262 4:76566738-76566760 ATCTCAAGTCAGATGGAACCAGG - Intronic
976148339 4:82066516-82066538 TGACTAAGACAGATGGAACTGGG + Intergenic
977599803 4:98923924-98923946 TTTCTAAGTCAGCTGAAAGTCGG - Intronic
977774007 4:100895839-100895861 TTTTCAAGTTAGATAGACCTGGG - Intergenic
978154997 4:105479478-105479500 ATTTTATGTTAAATGGAACTAGG + Intergenic
978375260 4:108068356-108068378 TTTTGAAGTCAGAGTGACCTGGG + Intronic
978887392 4:113780958-113780980 TTATTAAGTCATATATAACTTGG + Intergenic
978995653 4:115148505-115148527 TTTTTAAGTGAGATTGAGCGAGG + Intergenic
979276235 4:118817168-118817190 TTTTTAAAATAGATGTAACTAGG - Intronic
979315595 4:119258190-119258212 TTTTGAAGTCAGACCGATCTGGG - Intronic
980272203 4:130599471-130599493 TTTTAAAGTCAGATGAACCTGGG - Intergenic
980322470 4:131296710-131296732 TGTTTATGTCATATGTAACTTGG - Intergenic
980894391 4:138847863-138847885 TTTTTAAGTCAGTTTGAGCAGGG + Intergenic
980952472 4:139395219-139395241 CTTTTAGGTCAGACAGAACTAGG + Intronic
981841840 4:149122143-149122165 TTTTGGAGTCAGAGAGAACTGGG - Intergenic
981966706 4:150612475-150612497 TTTTTAAGACAGTTGGAAGCCGG + Intronic
982933732 4:161442885-161442907 TTTTAAAGCCAGATGGAATTTGG + Intronic
983856512 4:172653007-172653029 TTTTAAAGTCAGATGAAAGCTGG - Intronic
984002453 4:174266653-174266675 TTTTGAAGTCAGACAGACCTGGG + Intronic
984036166 4:174670636-174670658 TTCTTAAATCTGATAGAACTAGG - Intronic
984311806 4:178070372-178070394 TATTAATGTCAGATGAAACTTGG - Intergenic
984665425 4:182422430-182422452 TTTTTAAGGCAGCAGGGACTTGG - Intronic
984959073 4:185077016-185077038 TTTTCAAATCAGATGGACCTAGG + Intergenic
985173883 4:187180325-187180347 TATTTAATAGAGATGGAACTAGG - Intergenic
985212568 4:187610906-187610928 TTTTTATTTCAGCTGGAAGTTGG + Intergenic
985921105 5:2975413-2975435 TATTTCAGTCAGATTAAACTAGG + Intergenic
986567857 5:9133148-9133170 TTTTTAACTGAAATGGAACAAGG - Intronic
987844589 5:23266075-23266097 TTTTTATCTCACATGGAACATGG + Intergenic
987897450 5:23965772-23965794 TGTTTAAGTCAGAAAAAACTAGG - Intronic
989267577 5:39495560-39495582 TTTTTATGTCATATTGAAATGGG + Intergenic
989665088 5:43844842-43844864 TTTATAATTCCCATGGAACTTGG - Intergenic
989994022 5:50805500-50805522 TTTTAAAGTCAGAGAGAATTAGG - Intronic
991636744 5:68713796-68713818 TTCTGCAGTCAGATGGGACTAGG - Intergenic
993291280 5:86074665-86074687 TTGTTAAGTTAGAGGCAACTGGG + Intergenic
993372056 5:87104912-87104934 TTTGTAATCCAGATGGAAATAGG - Intergenic
994666117 5:102707623-102707645 TTATTAAGTCAGTTTGAGCTGGG - Intergenic
995174979 5:109165795-109165817 TATTAAAGTAAGGTGGAACTTGG + Intronic
995433685 5:112111293-112111315 CTTTTAGGTCAGAGGAAACTTGG - Intergenic
995938661 5:117550958-117550980 TTTTTAGGTCAAATATAACTTGG + Intergenic
996712864 5:126560897-126560919 TTTTGAAGGCAGAGGTAACTAGG - Intronic
997485764 5:134229261-134229283 CTCTGGAGTCAGATGGAACTGGG + Intergenic
998520420 5:142795158-142795180 TTTTGGAGTCAGATAGACCTGGG + Intronic
998601029 5:143585236-143585258 TGTTTAATTCAGTTTGAACTGGG + Intergenic
998633466 5:143926670-143926692 TTTTTAAGTCTATTGGAAATGGG - Intergenic
998801432 5:145873556-145873578 TTTTGGAGTCAGATAGATCTGGG - Intergenic
999333706 5:150696682-150696704 TTTCTAACTCTGATGGAACACGG - Exonic
999505031 5:152185855-152185877 TTGTGAAGTCAGGTGGATCTGGG - Intergenic
999909433 5:156181689-156181711 TTTATAAGTCAGATGATTCTTGG + Intronic
1000149138 5:158482497-158482519 GTTGTAAGTCAGAGGCAACTGGG - Intergenic
1000759734 5:165207624-165207646 TTTTTCAGTCAAATGGAGTTTGG + Intergenic
1000966328 5:167661616-167661638 TACTTAAGTCAGTTTGAACTGGG - Intronic
1001804873 5:174575008-174575030 TGTTTAAGTCAGCTGGGATTGGG + Intergenic
1001892747 5:175352850-175352872 GTTTGAAGTCAGATAGACCTGGG - Intergenic
1002691718 5:181054558-181054580 TTTTTAATGCAAATGGCACTAGG + Intronic
1003805018 6:9718399-9718421 TTTTAAAATCAGATGGAACTGGG + Intronic
1004117670 6:12787055-12787077 TTTTTCAGTCAGTTGGAAAATGG - Intronic
1004524852 6:16397598-16397620 TTCTTAAGTGAAATAGAACTAGG + Intronic
1006349192 6:33508497-33508519 CTTTTGAGTCAGCTGGAACTGGG + Intergenic
1006808539 6:36805170-36805192 TTTTCAAGCCAGAAGGGACTTGG + Intronic
1007676161 6:43596863-43596885 GTTTTAAGTCAGATGTTGCTTGG - Intronic
1009944459 6:70326498-70326520 CTTTGAAGTCAGACAGAACTAGG - Intergenic
1010097888 6:72068215-72068237 TTTGTGAGGCAGATGGAACATGG - Intronic
1012962505 6:105637002-105637024 TTTTCAAGACAGATGTTACTAGG + Intergenic
1013081106 6:106814086-106814108 TTTAAAATTCATATGGAACTGGG + Intergenic
1013952916 6:115806693-115806715 TTTTTTTGTCAGAAGGAAATTGG + Intergenic
1014170411 6:118273011-118273033 TTTTTAAGTCATTTGAAAGTAGG - Intronic
1015011778 6:128358188-128358210 ATTATAAGTCAAATGGAATTGGG - Intronic
1015025153 6:128523653-128523675 TATTTAAATCTGATAGAACTGGG - Intergenic
1015428331 6:133099196-133099218 TTTCTAAGTGAGAAGGAAATTGG + Intergenic
1016138949 6:140584570-140584592 TTTTGAAGTCTGATAGAATTTGG - Intergenic
1016675261 6:146757965-146757987 TGTTTAAGTCACAGGGAAGTGGG + Intronic
1016799466 6:148154172-148154194 TTTTGGAGTCAGATGGAGCTGGG + Intergenic
1017301902 6:152870644-152870666 TGTTTAAGTATGTTGGAACTAGG + Intergenic
1017723342 6:157259423-157259445 ATTTTAAGTCACAGGGAAATAGG + Intergenic
1021276571 7:18658950-18658972 ATTTTAAGACAGATTGTACTTGG - Intronic
1021906865 7:25343247-25343269 ATTTTAAATCAGAAGGAACTAGG + Intergenic
1022073415 7:26940672-26940694 TGTTTTAGTCAGATGTCACTTGG - Intronic
1022649820 7:32264459-32264481 TTTTTAAGTCAGATGGAACTAGG - Intronic
1023360106 7:39406769-39406791 TTTTTATGGCAGATTGAACTCGG + Intronic
1023529635 7:41138854-41138876 TTTTGAAATCAGATAGATCTGGG - Intergenic
1023742703 7:43294719-43294741 TTTTGAAGTCAGACTGACCTGGG - Intronic
1026382272 7:69811658-69811680 TTTTCAAGTCCCATGGACCTGGG - Intronic
1027008968 7:74725299-74725321 GTTTTAAGTCATATGGAACATGG - Intronic
1027785738 7:82576884-82576906 TTTTGAAGCCAGATGAACCTGGG + Intergenic
1028835179 7:95366699-95366721 CTTTGAATTCAGATGGATCTGGG + Intronic
1029035913 7:97521357-97521379 TTTTAAAGTCAGGTGGGGCTGGG - Intergenic
1030191676 7:106816760-106816782 CTTATAAGACACATGGAACTTGG + Intergenic
1031105493 7:117536991-117537013 TTGGTAACTCACATGGAACTGGG + Intronic
1031677452 7:124628319-124628341 TCTTTAGGTCAGATAGAATTTGG - Intergenic
1032806213 7:135357270-135357292 TTTGCAAGTCAGATGGATGTGGG - Intergenic
1034507480 7:151505193-151505215 TTTGTAAGTTTGATGAAACTCGG - Intronic
1035146471 7:156822425-156822447 TTTTGGAGTCAGATAGACCTGGG - Intronic
1037587658 8:20289002-20289024 TTTTTTAGACATATGGGACTTGG + Intronic
1038118686 8:24587129-24587151 TTTTTAGTTCAGATGGACTTGGG - Intergenic
1038923026 8:32106748-32106770 TTTTTAAAAAAAATGGAACTGGG + Intronic
1038945105 8:32350473-32350495 TTTGAAAGTCAGATGGACCTTGG + Intronic
1039010923 8:33091695-33091717 TGTTTAATTCAGAAAGAACTTGG - Intergenic
1040855086 8:51940700-51940722 TTTTTAAGTTATAAAGAACTAGG - Intergenic
1042533534 8:69837304-69837326 TTTTAAAGTCATATTTAACTGGG - Intergenic
1042533538 8:69837411-69837433 TTTTAAAGTCATATTTAACTGGG - Intergenic
1043097082 8:75988871-75988893 CTTTTAAGCCATATTGAACTAGG + Intergenic
1044797476 8:95918872-95918894 TTTTAAAGTTAGAATGAACTTGG - Intergenic
1044962462 8:97544066-97544088 TTTGTAAGTCAGAGTGAATTAGG - Intergenic
1045755886 8:105541369-105541391 TTTTGAAGTCAGATGGAGATGGG - Intronic
1046441723 8:114264015-114264037 TTTTTAAGTCAGGCTGAATTTGG + Intergenic
1046824917 8:118678000-118678022 TTTTTAGATCAGATGGAGCTTGG + Intergenic
1047305147 8:123646510-123646532 TATTGGGGTCAGATGGAACTGGG - Intronic
1047514499 8:125541917-125541939 TTTTGGAGTCAGATAGACCTGGG + Intergenic
1047891932 8:129322247-129322269 TTATTTAGTCAGATGGCTCTGGG - Intergenic
1047954308 8:129961572-129961594 TTTAGAAGTAATATGGAACTTGG + Intronic
1048240718 8:132739265-132739287 CTTTTAAATCAGATAGACCTCGG + Intronic
1048372222 8:133789111-133789133 TCATTAAGCCAGATTGAACTAGG - Intergenic
1049945035 9:586215-586237 CTTTGAAGTCAGATGTCACTGGG - Intronic
1051258832 9:15242044-15242066 TTTTTAAGTCAGAGTTAATTAGG - Intronic
1051757657 9:20421636-20421658 TCTTTAAGTCAGAATTAACTTGG - Intronic
1052597731 9:30582088-30582110 TTTTTAAGACAGAAGGAATACGG + Intergenic
1054936189 9:70691152-70691174 TATTTAATTTATATGGAACTTGG - Intronic
1057361657 9:94378793-94378815 TTTTTAAGGCAGATAGCATTTGG - Intronic
1057661699 9:97009380-97009402 TTTTTAAGGCAGATAGCATTTGG + Intronic
1057929722 9:99183323-99183345 TTTTTATGTAAAATGCAACTCGG + Intergenic
1059591196 9:115664394-115664416 TTATGAAGTCAGATGGAATGAGG + Intergenic
1059659397 9:116386598-116386620 CTTTTGAGTCAGATAGAACTGGG - Intronic
1059746354 9:117205493-117205515 TTTTGAAGTCATCTGGACCTGGG - Intronic
1187325487 X:18282848-18282870 TTTGTATGTCTGATGGAATTCGG - Intronic
1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG + Intergenic
1189239773 X:39516283-39516305 TATTTGAGTCAGGTGGATCTGGG - Intergenic
1189298415 X:39935375-39935397 TTTTGGAGTCAGATGGAACTGGG - Intergenic
1189455778 X:41187844-41187866 TTTTTAAGACAAAGGCAACTTGG + Intronic
1190393395 X:49955012-49955034 TTTTTTAGACAGATAGACCTGGG + Intronic
1190938379 X:55016918-55016940 TTTTCAAGTCAGAGAGACCTGGG - Intronic
1191673837 X:63774260-63774282 ATTAAAAGTCAGATGGACCTGGG - Intronic
1192813208 X:74567421-74567443 TCTTAAAATCAGATGGAGCTGGG - Intergenic
1194037111 X:88888318-88888340 TTTATAAGTCTGGTGGAATTTGG + Intergenic
1194144202 X:90243560-90243582 TTTATAAGCCAGAAGGAAATGGG + Intergenic
1194565365 X:95480588-95480610 CTTTTGAGTCAGGCGGAACTTGG - Intergenic
1195422294 X:104689007-104689029 TTTGAAGGTCAGATGGTACTAGG - Intronic
1196618508 X:117795251-117795273 CTTTGGAGTCAGATGGACCTAGG - Intergenic
1197404979 X:126038291-126038313 TTTGGAAGACAGATGGATCTTGG + Intergenic
1199297260 X:146173271-146173293 TTTTTTAGTCCTATGGACCTGGG - Intergenic
1200489966 Y:3812868-3812890 TTTATAAGCCAGAAGGAAATAGG + Intergenic