ID: 1022650387

View in Genome Browser
Species Human (GRCh38)
Location 7:32268504-32268526
Sequence CTTAAATCTCTTTTGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 12, 3: 45, 4: 373}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022650387 Original CRISPR CTTAAATCTCTTTTGGAACA AGG (reversed) Intronic
903035227 1:20488548-20488570 CTTTAACCTTATTTGGAACAAGG - Intergenic
905517654 1:38573774-38573796 CTTAAATCTTTTATGGAACAAGG + Intergenic
905727171 1:40262583-40262605 CTTTAGTCTTTTTTGGACCAAGG - Intronic
906016774 1:42588841-42588863 CTTTACCCTCTTTTGGAAAATGG + Intronic
907423542 1:54363834-54363856 CTTACAACTCTTCAGGAACAGGG + Intronic
907580526 1:55568267-55568289 GTTAAATCTTTTTTTTAACAAGG + Intergenic
907739502 1:57150981-57151003 TTTAAATTTCTTTTGAGACAGGG - Intronic
908584857 1:65556576-65556598 CTTAACCATTTTTTGGAACATGG - Intronic
909794640 1:79718653-79718675 CTAAAATCTCATCTGAAACAAGG + Intergenic
910208499 1:84771693-84771715 CTTAATTCCTTTATGGAACATGG + Intergenic
910631044 1:89354581-89354603 CTTGGATTTCTTTTGGATCAAGG + Intergenic
910673561 1:89796910-89796932 CCTAAACCTCTTTTGTAAAATGG - Intronic
910970582 1:92851859-92851881 CTTAAATCTTTGTTGCAACCAGG - Intronic
913082086 1:115398034-115398056 CTTCTATTTCATTTGGAACATGG - Intergenic
913254682 1:116943040-116943062 CATAAATCCTTTTGGGAACAAGG - Intronic
913388824 1:118288336-118288358 CTTAAATCTCTTGGGGGAAAAGG - Intergenic
913560173 1:120010557-120010579 ATTACATCTCTTTTACAACAGGG - Intronic
913637950 1:120783009-120783031 ATTACATCTCTTTTACAACAGGG + Intergenic
914624836 1:149450331-149450353 ATTACATCTCTTTTACAACAGGG + Intergenic
915086602 1:153393529-153393551 CTTAAATCATTTCTGGAAGAAGG + Intergenic
918386072 1:184009350-184009372 CTTCAATCCTTTTTGGAAAAGGG + Intronic
919035402 1:192301365-192301387 CTTAATTCCATTTTGGAAGAAGG - Intergenic
919078356 1:192839474-192839496 GTTAAATCTCTCCTGGATCAGGG + Intergenic
919489445 1:198187495-198187517 AGTAAATCTGTTTTGGAACCTGG + Intronic
919970462 1:202573706-202573728 TTTAAATGTCTTATGGAATATGG + Intronic
920274609 1:204794828-204794850 CTTAAATCCATTTTGGAACAAGG + Intergenic
920911495 1:210221897-210221919 CTTAAATCATTTCTGAAACAAGG + Intergenic
922639682 1:227216453-227216475 CTAAAATCTTTTCTGGAATAAGG + Intronic
922678660 1:227571335-227571357 ATAAAATCTTGTTTGGAACATGG - Intronic
922869609 1:228891524-228891546 TTGAAATCCCTTTTGGAACCAGG - Intergenic
924390102 1:243545104-243545126 TTTAAATTTCTTTTAAAACAAGG + Intronic
1062906403 10:1182641-1182663 CTTAAATCTTTTTTGAAAGGAGG + Exonic
1063717884 10:8546548-8546570 CTTAAATCTCTTTTGAATGTAGG - Intergenic
1064241100 10:13629887-13629909 CTTAATTCTCTATTGGAACCTGG + Intronic
1064418998 10:15174039-15174061 ATTATATCTCTTTTGAGACAGGG + Intergenic
1064892959 10:20199936-20199958 TTTAAATTTATTTTGGAATAGGG - Intronic
1065127582 10:22588594-22588616 CTTAAATCCTTTCTGGAATAAGG + Intronic
1065212485 10:23417741-23417763 GTTAATTCTCTTTTGGACCAGGG - Intergenic
1065635807 10:27732752-27732774 CTTCATTTTCTTTTGCAACAGGG + Intronic
1067443183 10:46323947-46323969 CTTAAATGTCTTTTGGTTCCAGG + Intronic
1068497855 10:57808088-57808110 CTTAAATCCCTTTTGGGAGGCGG + Intergenic
1068948538 10:62754600-62754622 ATAAAATCTCTTTTGGAAATGGG + Intergenic
1070086208 10:73239522-73239544 CTAAAATTCATTTTGGAACATGG + Intronic
1070456142 10:76619433-76619455 CCAAAGTCTCATTTGGAACAAGG + Intergenic
1070688655 10:78508833-78508855 CTTAGAGCCCTTTTGGAGCAGGG + Intergenic
1071519615 10:86321285-86321307 TATAAATCTCTTCTGCAACAAGG + Intronic
1071728885 10:88228003-88228025 TTTACATCTCTCTTGGAAGAAGG + Intergenic
1073312449 10:102553186-102553208 TTTAAATTTTTTTTAGAACATGG + Intronic
1073604247 10:104877964-104877986 CTGAAATCCCTTCTGGAAAATGG - Intronic
1073719370 10:106149313-106149335 TTTAAATCATTGTTGGAACAAGG + Intergenic
1073984506 10:109193157-109193179 CATAAATATCTGTTGAAACAAGG + Intergenic
1074341467 10:112634793-112634815 CTTAAATGCCTTTTAGAACATGG - Intronic
1076391539 10:130106336-130106358 CTTCATACTCTTTTTGAACAAGG - Intergenic
1079520857 11:21324885-21324907 CATAACTCTCTTTTTAAACAAGG - Intronic
1080441557 11:32299328-32299350 TTTAAATCCTTTTTGGAACAAGG - Intergenic
1080499551 11:32856605-32856627 ATTAAATCTATTTTGACACAAGG + Exonic
1080527292 11:33136782-33136804 CTTTAATACCTTTTGGGACAGGG + Intronic
1082890849 11:58137145-58137167 TTTAAATCTCTTTTGGAAAGAGG - Intronic
1084336156 11:68459307-68459329 CTCAAATCCATTTTGGAATAAGG + Intergenic
1085073092 11:73565987-73566009 CTTAAGTGTCTTTGGGAAAAAGG - Intronic
1085750497 11:79156808-79156830 CTTAAATTATTTTTGGAGCAAGG - Intronic
1085852859 11:80141831-80141853 CTTGAATCCTTTCTGGAACAAGG + Intergenic
1089439473 11:118503228-118503250 AGTAAATCTTTTTTGGAACCTGG + Exonic
1091111853 11:132976873-132976895 CTCTAATCTCTTTTGAAATAAGG - Intronic
1091960656 12:4691474-4691496 CTTAAATCCTTTCTGGAACAAGG - Exonic
1092839227 12:12522965-12522987 CTTAAACTGTTTTTGGAACAAGG - Intronic
1093105624 12:15082879-15082901 ATCAAATCTTTTTTGGAAAAGGG - Intergenic
1094216293 12:27946281-27946303 CTCAAATCCCTTGTAGAACAAGG + Intergenic
1097622588 12:61958918-61958940 CTGAAATTTATTTTTGAACATGG + Intronic
1098265478 12:68714497-68714519 CATAATTCAATTTTGGAACATGG - Intronic
1098987446 12:77028024-77028046 CTGAAATCTCTTCTGCAGCAGGG + Exonic
1099348121 12:81528342-81528364 CCTAATTCTATTCTGGAACATGG - Intronic
1099737179 12:86584619-86584641 CTTCAATTTCTATTGGATCAAGG + Intronic
1100069730 12:90699243-90699265 GTTAAAGCTCATTTGGAATAAGG - Intergenic
1100094833 12:91021210-91021232 CTAAAATATATTTTGCAACATGG + Intergenic
1100486043 12:95028628-95028650 CTTAAATTTTTTTTGAGACAGGG + Intronic
1100810415 12:98331795-98331817 CTCAAAACTATTTTGGAAGAAGG - Intergenic
1101370866 12:104129026-104129048 CTTATATCACTTATGGAAGATGG - Intronic
1101620918 12:106386999-106387021 CTTAAATCCTTTTTAGAATAGGG + Intronic
1102061964 12:109939348-109939370 CCCAAATCTCATTTGGGACAGGG + Intronic
1102260741 12:111441907-111441929 CTAAAATCATTTTTGGAAGAAGG + Intronic
1103410096 12:120705250-120705272 CAGAAATCTCTTTTGGAAACAGG + Intergenic
1104308340 12:127630937-127630959 CTAAAATGTATATTGGAACAAGG + Intergenic
1104412204 12:128568376-128568398 CTAAAATCCTTTGTGGAACAAGG - Intronic
1106876623 13:34081349-34081371 CTTGACTCACTTTTCGAACAGGG - Intergenic
1107060612 13:36155656-36155678 TTTAAATCTATTTTTAAACATGG - Intergenic
1108384972 13:49890881-49890903 CTTCATACTCTTTTTGAACAAGG - Intergenic
1108590647 13:51910309-51910331 CTTCATACTCTTTTTGAACAAGG + Intergenic
1109230657 13:59752686-59752708 CTTCAGTCTCTTTTAAAACAAGG + Intronic
1109243497 13:59923133-59923155 GTTAAATAACTTTTTGAACACGG - Intronic
1109948529 13:69469842-69469864 ACTAATTCTATTTTGGAACAAGG - Intergenic
1110050412 13:70889777-70889799 ATTATATATTTTTTGGAACAGGG + Intergenic
1112022870 13:95386651-95386673 CTTACATCTCTGTAGGAAAAAGG + Intergenic
1112185917 13:97127648-97127670 GTTAAATCTCTCTTGGATCCTGG + Intergenic
1113641909 13:111963646-111963668 CTTTATTCTCTTTTGGGGCAGGG + Intergenic
1114805598 14:25832821-25832843 CTTAGAGCTCTCTTTGAACAGGG - Intergenic
1114862574 14:26543245-26543267 CTCAAACTTTTTTTGGAACAAGG + Intronic
1114928891 14:27442473-27442495 CTTCACTTTCTTCTGGAACATGG + Intergenic
1115309376 14:31964185-31964207 CTTATATCCATTTTGGAACAAGG + Intergenic
1117378183 14:55134851-55134873 CACACATCTCTTTTTGAACATGG - Intronic
1117593464 14:57301138-57301160 CTCAAATCATTTTTGGAATAAGG + Intergenic
1117924543 14:60764703-60764725 GTGAAATCTCTTCTGGAACAAGG + Intronic
1118862436 14:69674890-69674912 CTGAAGTCTCTGTTGAAACAGGG + Intronic
1119440097 14:74622419-74622441 CTTAAATCTTTTTTGAGACAGGG + Intergenic
1119528275 14:75340686-75340708 CCTAAATCTCTTGTTGCACATGG + Intergenic
1119773116 14:77233804-77233826 CTTCAATCTCTTTCAGCACATGG - Intronic
1119787165 14:77322148-77322170 CTAAAATCCCATTTGGAAGAGGG - Intronic
1120052072 14:79878259-79878281 CTGAAATCTCTTTAAGGACAAGG + Intergenic
1120189910 14:81431249-81431271 CTCAAATCTCAACTGGAACAAGG + Intronic
1120605540 14:86571280-86571302 CTTCAATATCGTTTGGAACTGGG + Intergenic
1121073536 14:91047175-91047197 CTTACATCTTTTCTGGACCAAGG - Intronic
1121396987 14:93634200-93634222 CTTAAATCATTTTTGAAACATGG + Intronic
1121809013 14:96862897-96862919 CTCAGATCTCTTTTGGAAAGGGG + Intronic
1125360431 15:38858897-38858919 CTTAAATCATTTTAGCAACAAGG + Intergenic
1125809172 15:42522210-42522232 CTCAAATCCTATTTGGAACAAGG + Intronic
1125809571 15:42526298-42526320 GTTAAATTTTTCTTGGAACAAGG - Intronic
1126158651 15:45587967-45587989 CTTAAATCCCTCCTGGAACTCGG - Intronic
1126335762 15:47584649-47584671 CTTAAATCTGTTTTAGAAGTAGG + Intronic
1126743319 15:51799876-51799898 GTTAAATATACTTTGGAACAGGG - Intronic
1126751253 15:51878822-51878844 CTTCAATCTTTTCTGGAACAAGG + Intronic
1127270063 15:57392381-57392403 TTTAAATCTCTTTTGGTACCTGG + Intronic
1127768538 15:62211338-62211360 CCTAAATGTCTTATGGAAAATGG + Intergenic
1128051083 15:64665448-64665470 CTTAAATCACTTTTTGAGGAAGG - Intronic
1128493375 15:68173163-68173185 CTTAAATTTTTTTTGGATCAAGG + Intronic
1129927057 15:79374047-79374069 GTTAAATCTCTCCTGGATCAAGG + Intronic
1130529177 15:84732943-84732965 TTTAAATTTCTTTTGAGACAGGG - Intergenic
1131678725 15:94699523-94699545 CTCAAATCTCTTTTGCAGGAAGG - Intergenic
1131713758 15:95085738-95085760 CTGAAATCATTTTTGGATCAAGG + Intergenic
1132363914 15:101242147-101242169 CTTAAATCCCTTCTGTAACAGGG - Intronic
1133719419 16:8480733-8480755 CTTAAATCTTTTCTGGAATGGGG - Intergenic
1135512882 16:23102965-23102987 CTTTAATCCCTTTTATAACATGG - Intronic
1137932546 16:52602783-52602805 TTCAAATCCATTTTGGAACAAGG + Intergenic
1138043110 16:53696041-53696063 CTTGAATCTTGTTTGGAACAAGG - Intronic
1138854553 16:60673097-60673119 TTTACATTTCTTTTGAAACAAGG + Intergenic
1139281295 16:65773174-65773196 CTAATATGTCTTTTGGTACAAGG + Intergenic
1140131934 16:72170387-72170409 CTTAAATCCTTTCTGGAACAAGG + Intronic
1140874189 16:79135480-79135502 CTTAAATCTCTTTTAATAGATGG - Intronic
1141076676 16:81012178-81012200 CTTACATCTCTTTTGGAGTAAGG - Intronic
1143344074 17:6237042-6237064 CTTAAATCCTTTTAGGAACTTGG + Intergenic
1145244243 17:21257817-21257839 CAGAAATCCCTTCTGGAACAAGG + Intergenic
1147430040 17:40365187-40365209 TTTACATCTTTTTTGGAACGGGG + Intergenic
1148350970 17:46942021-46942043 CTCAAATCTTTTTTGGACTAAGG - Intronic
1149030332 17:52075558-52075580 CTTGAATGTCTGTTGGGACATGG + Intronic
1149100757 17:52903747-52903769 CCTAAATCTCTTTTTAAAAATGG - Intergenic
1149791523 17:59481902-59481924 CTGAAATCCTTTCTGGAACAAGG - Intergenic
1150444236 17:65216120-65216142 CTCAAATCCCTTCTGGAAGAAGG - Intronic
1150779897 17:68113131-68113153 CTCAAATCATTTTTGGAAAAAGG + Intergenic
1150787471 17:68174718-68174740 CTTAAATCTCTTTTAATCCATGG + Intergenic
1151526611 17:74673930-74673952 CTTAAAACTCTTTTTGTAAAGGG + Intronic
1152121118 17:78419311-78419333 CTTAAAAGTCTTTAGGAACACGG + Intronic
1153270056 18:3311609-3311631 CTCAAATTTATTTTGGAATAAGG + Intergenic
1153530416 18:6040635-6040657 CTCACATCTCTTTTGAGACAAGG + Intronic
1155081745 18:22417589-22417611 CTTCATACTCTTTTTGAACAAGG + Exonic
1155702864 18:28769277-28769299 CTTAAATCTTTTTTGGGAGGGGG - Intergenic
1156541024 18:37910647-37910669 CTTCAATCTCTCTAGGAACCTGG + Intergenic
1157495751 18:48156090-48156112 CTCAAATCCTTTTGGGAACAAGG - Intronic
1157740500 18:50088729-50088751 TATAAATCACTTTTGGAAGATGG - Intronic
1158504800 18:58037526-58037548 CTCAAAGCTGTTGTGGAACATGG - Intergenic
1158763013 18:60412832-60412854 GTAAAATATATTTTGGAACATGG + Intergenic
1159578376 18:70206645-70206667 CTTAAGTCTCTTTTATAAAATGG + Intergenic
1160095825 18:75871952-75871974 CTTAGATTCCTTTTGGAAGAAGG - Intergenic
1160573320 18:79833115-79833137 CCTAAATCTCTCTTGCTACAGGG + Intergenic
1162962076 19:14134276-14134298 GTTAAATCCTTTCTGGAACAAGG - Intronic
1165257001 19:34583728-34583750 TTTAAATCTTTTTTGAGACAGGG + Intergenic
925634123 2:5925972-5925994 CTTAAATCTGAGCTGGAACAAGG + Intergenic
926071617 2:9898396-9898418 CTCAAATCTTCTGTGGAACAAGG - Intronic
926673943 2:15603416-15603438 TTCAAATCCTTTTTGGAACAGGG - Intronic
927278672 2:21284283-21284305 TTTAAATTTATTTTGGAAGATGG + Intergenic
927607424 2:24499746-24499768 CTTAAATCCTTTTTGGAACATGG - Intronic
928352602 2:30573879-30573901 TTTAAATCTTTATTGGAACACGG - Intronic
929763255 2:44823660-44823682 CCTATATCCTTTTTGGAACAAGG - Intergenic
929875489 2:45793119-45793141 CTTAAATCTATTCTGGAACAAGG - Intronic
929975960 2:46634890-46634912 GTTAAATTACTTTTGAAACATGG - Intergenic
930328840 2:49956780-49956802 CTAAAATATTTTTTGGTACAAGG + Intronic
930899302 2:56484254-56484276 CTTTCATCTTTTTTGTAACATGG + Intergenic
931454523 2:62398157-62398179 CTGAAATTTCTTTGAGAACATGG + Intergenic
931744168 2:65277436-65277458 TTCAAATCCCTTTTGGAAAAGGG + Intergenic
932137931 2:69246911-69246933 CTCAGATCTTTTCTGGAACAAGG + Exonic
932728560 2:74200255-74200277 TATAAATCTCTTTTGGACCATGG - Intronic
932913725 2:75832877-75832899 TTTAAATCTCTTTTGCAATGAGG - Intergenic
932939794 2:76150146-76150168 CTCAAATCTATTTTGGACAATGG - Intergenic
932957472 2:76370821-76370843 CTTAGATCTATTTGGGAACATGG + Intergenic
933345404 2:81078743-81078765 GTTAATTCTCTCTTGGATCAGGG - Intergenic
934533071 2:95108057-95108079 TTCAAATCTTTTTTGGAAAAAGG + Intronic
935407551 2:102724875-102724897 TATAAATCTCTTTTGGAATTAGG + Intronic
935672379 2:105566777-105566799 CTTAAATCACTTTGGGTTCATGG + Intergenic
937049666 2:118878268-118878290 CGTAAATATCTTTTGGAAGTAGG + Intergenic
937409894 2:121665204-121665226 ATAAAATACCTTTTGGAACATGG - Intergenic
937776381 2:125781626-125781648 CTTATACCTATTGTGGAACAGGG + Intergenic
938174005 2:129107690-129107712 CTCAAATCTCGTTTGTGACATGG - Intergenic
938267628 2:129939971-129939993 TTCAAATATCTTTTGGAAAAAGG + Intergenic
939515628 2:143164229-143164251 CCCACATCTCTTTAGGAACATGG - Intronic
939803237 2:146739081-146739103 CTTAAATCAATTTAGGAGCACGG - Intergenic
940377705 2:152974731-152974753 CTTAAATGTCAGTTGGAATACGG - Intergenic
940771798 2:157846628-157846650 CTTAAATTGTTTCTGGAACAAGG - Intronic
941561586 2:167052712-167052734 TTTAAATGGCTTTTGGATCAGGG - Intronic
941615639 2:167715752-167715774 CTTCATACTCTTTTGGAATAAGG + Intergenic
941646000 2:168042233-168042255 CTTAAATCTTCTCTGGAACAAGG + Intronic
942153524 2:173103483-173103505 CTTAAATCCTTTTTGAAACAAGG - Intronic
942255052 2:174088707-174088729 CTTAGCTCTCTTTTAGAAGAGGG - Intronic
942520062 2:176794410-176794432 TATAAATCCTTTTTGGAACAAGG + Intergenic
942611074 2:177743119-177743141 TTTAGCTCTCTTTTGGGACAAGG + Intronic
942799396 2:179859631-179859653 CTCAAATCACTTTTGGAAATAGG + Intronic
943497133 2:188634992-188635014 TTTATATTTCCTTTGGAACATGG + Intergenic
943502348 2:188707570-188707592 ATTAAATCTATATTGGCACAGGG - Intergenic
945339905 2:208640100-208640122 CTTAAACCCCTTATGGAAGAGGG - Intronic
945414559 2:209554984-209555006 TTTAAATCCCTTCTGAAACAAGG - Intronic
946425431 2:219592908-219592930 ATTAAATCTCTTCCGGAACCAGG + Intergenic
946574553 2:221060328-221060350 ATTAAATCTCTCTTGACACATGG - Intergenic
947510117 2:230744662-230744684 CTTAAATTCTTTCTGGAACAAGG - Intronic
948082491 2:235217923-235217945 CTTAAAGCTAATTTGGAAGAGGG + Intergenic
948715593 2:239859175-239859197 CTTACATCTTTTTTGGCATAGGG - Intergenic
949020778 2:241740136-241740158 CTTTTATTTCTTTTGAAACAGGG - Intronic
1168858043 20:1023132-1023154 CTTAAATCATTTTTGCAACAAGG - Intergenic
1169173702 20:3489288-3489310 TTTAAATTTTTTTTTGAACAAGG + Intronic
1170587015 20:17742503-17742525 CTTAAATGTCATTTCCAACAAGG - Intergenic
1171567943 20:26212113-26212135 CTTACATCACTGTTGGCACATGG - Intergenic
1171723206 20:28587301-28587323 CTTAAAACTCTCTTGCAAAAAGG - Intergenic
1171754842 20:29095806-29095828 CTTAAAACTCTATTGCAAAAAGG + Intergenic
1172920685 20:38479324-38479346 CTTGAAGCTCCTTGGGAACAGGG + Intronic
1174346746 20:49936077-49936099 ATTTAATCTATTTTGGGACAAGG - Intergenic
1175103686 20:56598577-56598599 CTGTAATCTTTTTTGGAATAAGG + Intergenic
1175567710 20:59994014-59994036 CTCAAATCACTTGTAGAACAAGG - Intronic
1176203598 20:63876032-63876054 CTTTAAACTTTTGTGGAACAGGG + Intronic
1176727739 21:10455899-10455921 CATAAGTCTATTTTGGAAAAAGG - Intergenic
1177807169 21:25885724-25885746 CTCAAAGCTATTTTAGAACAAGG - Intronic
1177930564 21:27277903-27277925 ATAAAATTTCTTTTAGAACAGGG + Intergenic
1178280664 21:31279913-31279935 CTTAAATTTGCTGTGGAACAAGG + Intronic
1178286420 21:31329082-31329104 GCTTAATCTCTTTTGGAAAATGG - Intronic
1178636140 21:34305954-34305976 GTTAAATTTCTTTTGGAAAGTGG + Intergenic
1178886845 21:36491605-36491627 CTGAAATCCTTTTTGGAACAAGG + Intronic
1178938078 21:36881622-36881644 CGTAATTCCTTTTTGGAACAGGG + Intronic
1179088344 21:38240588-38240610 ATTAAAACTGTTTTGGAAGAAGG - Intronic
1180286658 22:10751138-10751160 CATAAGTCTATTTTGGAAAAAGG + Intergenic
1180296767 22:10945951-10945973 CTTAAAACTCTCTTGCAAAAAGG - Intergenic
1183034626 22:35131894-35131916 CTTAAATCCTTTGGGGAACAAGG - Intergenic
1184514248 22:44951901-44951923 CTCAAATTTCTTTTGGAAAGAGG + Intronic
949293580 3:2494589-2494611 GTTAAATCTCTCCTGGATCAGGG + Intronic
949387928 3:3525429-3525451 CATAAATTGCTTCTGGAACAAGG - Intergenic
951047585 3:18057775-18057797 CTTAAATGTCATTTGGAGAAAGG + Intronic
951931844 3:27976315-27976337 CTTATATGTCTGTTGGAATATGG - Intergenic
951967928 3:28408871-28408893 TCTGAATCTCTTTTGGTACAGGG + Intronic
952291890 3:32024956-32024978 CCTACTTCTCTTTTGCAACATGG + Intronic
954076285 3:48183672-48183694 CTTTAGTCTCTTTTGAGACAAGG - Intronic
954894241 3:53962551-53962573 CTTAAATCCTTTTTGGAACAAGG - Intergenic
955138122 3:56240507-56240529 CTTAAATATTTTTTTAAACAGGG - Intronic
955224913 3:57052650-57052672 CTTAAAGCTTTTATGGAACACGG + Intronic
957031439 3:75246709-75246731 TTTAAATCTTTTTTGGAGGAAGG + Intergenic
957156044 3:76545917-76545939 CTTAAAACCCTTTCAGAACATGG - Intronic
957430430 3:80098329-80098351 CTTACATTTATTTTGAAACAAGG + Intergenic
957594601 3:82246344-82246366 CTTAAGTCTCTTATGTAAAATGG + Intergenic
959538599 3:107514905-107514927 TTTATATTTCTTTTGTAACAGGG + Intergenic
960104565 3:113780541-113780563 CTTAAAACTCTTCTGGGACATGG - Intronic
960158778 3:114326243-114326265 CTCAAATCCTTTTTGGAATAAGG - Intergenic
960621092 3:119637571-119637593 TTTAAATCTCTATAGGAAAAAGG + Intronic
960942008 3:122941063-122941085 CCTAAATCCCTTTCGGAACAAGG + Intronic
962473770 3:135737923-135737945 CTTAAAGCCCTTTTCTAACAAGG + Intergenic
962909417 3:139834528-139834550 CTCAATTCTCATGTGGAACATGG - Intergenic
962917674 3:139919703-139919725 CATTACACTCTTTTGGAACAAGG - Intergenic
963226692 3:142869510-142869532 CTTAATTCTCTCCTGGATCAGGG - Intronic
963402689 3:144821124-144821146 ATTAAATATTTTCTGGAACAAGG - Intergenic
964857130 3:161158677-161158699 CTTAAATTTGTTTTGGCAAAGGG + Intronic
965777919 3:172253158-172253180 CTTAAATCAGTTTTGGTGCAAGG - Intronic
965887736 3:173469269-173469291 CTAAAATCTCTTTTCAAAGAGGG + Intronic
966030442 3:175339928-175339950 GTTATATCTCTTTTAGAAAATGG - Intronic
966643759 3:182219434-182219456 CTTAAATCCATTTTGGAAACAGG - Intergenic
966649508 3:182283628-182283650 CTTAAGTCTGTTTTGGTGCAAGG - Intergenic
966718891 3:183041265-183041287 CTTAAATCATTTTTGGAATGAGG + Intronic
967019988 3:185514285-185514307 CTTATATCTTTTATAGAACAAGG + Intronic
970589906 4:17550486-17550508 CTTAAATCTCTTCTGGAATAAGG + Intergenic
970752186 4:19377161-19377183 CAGAAATTTCTTCTGGAACAAGG + Intergenic
970798529 4:19944752-19944774 CCTAAATCACTGTTCGAACATGG - Intergenic
971092072 4:23357232-23357254 AGTAAATATATTTTGGAACACGG + Intergenic
971136516 4:23874466-23874488 CTTAAAGCTCTGTTTAAACATGG + Intronic
971220681 4:24703319-24703341 ACTAAATCACTTTTAGAACAAGG + Intergenic
971872317 4:32258597-32258619 TTTAATTCACATTTGGAACATGG + Intergenic
972472118 4:39416052-39416074 TTTAAATCCTTTCTGGAACAAGG - Intronic
972747379 4:41950121-41950143 CTTCAAACTCTTCTGGCACAAGG - Intronic
973076778 4:45938637-45938659 CTTAATTCTCTTTTGAAACAAGG + Intergenic
973336528 4:48962236-48962258 ATTAATTCTCTCTTGGATCAGGG + Intergenic
974446018 4:61982816-61982838 CTTAAATCATTTTTGAAACAAGG + Intronic
974672142 4:65046154-65046176 CTAAAATCTCTTTTGTACAAAGG - Intergenic
975445898 4:74465164-74465186 ATTAAAGCTCATTTGGCACATGG - Intergenic
975452317 4:74543615-74543637 CTTAAATCTCTCAGGCAACAAGG + Intergenic
975664273 4:76719385-76719407 CTCAACTCTCATTTGGAACTGGG - Intronic
975808166 4:78135098-78135120 CTTATCTCTCTTTTGTAATATGG - Intronic
976250676 4:83048460-83048482 TTTAACTCCTTTTTGGAACAAGG + Intronic
976412156 4:84727330-84727352 CCTAAATCTGTGTTGTAACAGGG + Intronic
978854704 4:113381227-113381249 TTAAAATGTGTTTTGGAACAAGG - Intronic
979433815 4:120664926-120664948 CCTAAATCCTTTTTGGAAAATGG + Intergenic
979534870 4:121808188-121808210 CTTAAATTCCTTTAGAAACAAGG + Intronic
979950314 4:126884834-126884856 CTCAAATCCTTTTTGGAAGAAGG + Intergenic
981207800 4:142065104-142065126 CTTAAATTCTTTTTGAAACATGG - Intronic
982331853 4:154189740-154189762 GTCAAATCTGTTTTTGAACATGG + Intergenic
983280849 4:165679324-165679346 ATTAAATCTCCTTTGGAACCAGG - Intergenic
983854312 4:172622970-172622992 CTTAAATCTCTTAGTGAACTAGG - Intronic
984497046 4:180511575-180511597 CTAAAATCTTATTTGGAATAAGG + Intergenic
987394185 5:17406304-17406326 CTTAGATCTCATTGGTAACATGG - Intergenic
987962700 5:24830815-24830837 ATGAAATATATTTTGGAACAGGG + Intergenic
988608723 5:32704857-32704879 CTCAAATCCTTTTTGGAAGAAGG + Intronic
988830626 5:34983564-34983586 CTTAAATCCTTCTTGGAACAAGG - Intergenic
988903621 5:35761460-35761482 CTCAAATTCTTTTTGGAACAAGG - Intronic
989179340 5:38560920-38560942 CTTAAGTCCCTTTTGGAAGAAGG - Intronic
989994185 5:50808209-50808231 CCAAAATCCCTTTTGGAAAAGGG - Intronic
990123089 5:52480202-52480224 GTTAAATCTCTTCTGGATCCTGG - Intergenic
990423053 5:55656653-55656675 CTTAAATCCTTTTTGGAGCAAGG + Intronic
990433643 5:55764984-55765006 CTTAAAACACTTTTGGTATAAGG + Intronic
992578226 5:78142308-78142330 CTCAAATTCCTTTTGGAATAGGG - Intronic
992921347 5:81525077-81525099 ATGAACTCTCTTTTGGCACAAGG - Intronic
993428473 5:87800067-87800089 ATTAAGTCACTTTTGAAACATGG - Intergenic
993783613 5:92100905-92100927 TTTAAGTCTGTTTTGGACCATGG + Intergenic
993848356 5:92973895-92973917 TCTTAATCTCTTTTGGATCATGG + Intergenic
994554299 5:101278338-101278360 GTTTAATTTCTTTTGAAACAGGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
998867672 5:146521571-146521593 CTTAGATATCTTTTCTAACAGGG - Intergenic
1000235849 5:159359910-159359932 CTTAAATCTTATTTGAAATATGG - Intergenic
1001216298 5:169859005-169859027 TTTAAATATATTTTGAAACAGGG - Intronic
1001300107 5:170527288-170527310 CTCAAGTCTCTTTTGTAATAAGG - Intronic
1003894641 6:10595609-10595631 CTTAAGTCCTTTCTGGAACATGG - Intronic
1004692522 6:18004640-18004662 CTTAATTCTCTTGTGGAACCTGG + Intergenic
1004802149 6:19160748-19160770 CTTAAATCATCTGTGGAACAAGG + Intergenic
1005051165 6:21685248-21685270 TTTAGATCTCCTTTGGAACATGG + Intergenic
1005357983 6:25002937-25002959 CTTAAATCACTTTTTGTACTTGG - Intronic
1007917591 6:45575531-45575553 CTTAATTCTCTTTTTCACCAAGG + Intronic
1008319130 6:50085403-50085425 CTCAACTCTCATTTGGAAGAAGG + Intergenic
1008483284 6:52008431-52008453 TTTAAATCTCCTTCAGAACATGG + Intronic
1008918324 6:56814878-56814900 TTCAAATCATTTTTGGAACATGG - Intronic
1009584925 6:65588106-65588128 CTCAATTCCCTTTTGGATCAAGG - Intronic
1010022771 6:71180190-71180212 CTGAAATGTCTGTTGGAATAGGG + Intergenic
1010160231 6:72845400-72845422 GTTAAATAGCTTTTGGATCAAGG - Intronic
1010854372 6:80819353-80819375 CTTAATTGTTATTTGGAACAAGG + Intergenic
1012384620 6:98664900-98664922 ATTAAATAACTTTTGAAACATGG - Intergenic
1012633952 6:101511099-101511121 GGTAAATATCTTTTGGAACTGGG + Intronic
1012706180 6:102534941-102534963 CTCAAACATTTTTTGGAACAAGG - Intergenic
1012897077 6:104961933-104961955 ATTAGATCTCTTTTGGAGAAGGG + Intronic
1013641063 6:112082427-112082449 AATAAATCTATTTTGGAACAAGG - Intronic
1013818817 6:114131530-114131552 CTTAAACTTCTTAGGGAACATGG + Intronic
1016053584 6:139555286-139555308 CTTAAATCCTTTCTGGAACAAGG - Intergenic
1016098373 6:140066217-140066239 CTGAAATCTCTTTTTCAACTTGG - Intergenic
1016267253 6:142246883-142246905 CTTAAACCTCTTCTTTAACATGG + Intergenic
1017696058 6:157017513-157017535 CTTAAATCCCTTTGGGAACAAGG - Intronic
1018081639 6:160263807-160263829 TTTAAATTTTTTTAGGAACAGGG - Intronic
1018141223 6:160838793-160838815 TTTAAATCTTTCCTGGAACAGGG + Intergenic
1018336838 6:162801019-162801041 CTTAAATCTTTCTGGAAACAAGG + Intronic
1018492049 6:164303791-164303813 CTGAAATCTCCTTTGGAAGCAGG - Intergenic
1018609559 6:165634490-165634512 CTTAAATGTTCTCTGGAACAAGG - Intronic
1018858485 6:167692963-167692985 TTTAAATATTTTTTAGAACAGGG - Intergenic
1019822828 7:3258325-3258347 CTTAAATATCTTTAGGAGAATGG + Intergenic
1020798686 7:12706760-12706782 GTTAAAACTCTGTTGGAAGAGGG + Intergenic
1021419000 7:20423676-20423698 ATTAACTCTATTTGGGAACAAGG + Intergenic
1022568634 7:31428826-31428848 CTTAAATCTTTTTTAGGAGAAGG - Intergenic
1022650387 7:32268504-32268526 CTTAAATCTCTTTTGGAACAAGG - Intronic
1022846129 7:34211784-34211806 AATAAATATTTTTTGGAACATGG + Intergenic
1023319776 7:38981971-38981993 ATTAAATACTTTTTGGAACAAGG - Intronic
1023601784 7:41887738-41887760 CTAAAATCTTTTTAGCAACAAGG + Intergenic
1023810802 7:43910061-43910083 CTTATATGTCTCTTGTAACAGGG - Intronic
1024455283 7:49599127-49599149 CTGAAAGCCCTTTTGGTACATGG + Intergenic
1026566187 7:71491479-71491501 CTTAAATCTTCCTTGGAACAAGG - Intronic
1027421476 7:78020974-78020996 CTTAAATCCTTTTTGGAAGTAGG - Intronic
1027876120 7:83770990-83771012 CTTATATCTCTTTTCAAAGAGGG - Intergenic
1028096011 7:86761887-86761909 CTTAATTCTCTGTTGGGAAAGGG - Intronic
1028441862 7:90872092-90872114 CTTCAATCTCTTTAAAAACAAGG - Intronic
1029541614 7:101186291-101186313 TATAAACCTCTTTTAGAACAGGG + Intergenic
1030024027 7:105304545-105304567 CTTAAATCCTTTTTGGAACAAGG + Intronic
1030200106 7:106894209-106894231 CTTAAATCCTTTTTGGAACAAGG + Intronic
1030548422 7:110928014-110928036 CTCAAATCTATTTTAGAGCAGGG + Intronic
1030831471 7:114227681-114227703 CTCAAATCTTTTTTGAAATAGGG - Intronic
1032634444 7:133691128-133691150 CTTAAATCTTTTGTGGATGAAGG - Intronic
1033025893 7:137771978-137772000 CTTAACTCTGAATTGGAACAAGG - Intronic
1033399476 7:141008224-141008246 CTTAACTATCTTTGGGGACAGGG - Intronic
1033447069 7:141432505-141432527 CTTAAGTCTTTTTTGGAACATGG + Intronic
1033574587 7:142668453-142668475 CTTAAATCTCTTATATAAAATGG - Intergenic
1034007866 7:147494090-147494112 CTGAAATCACTTTTTGCACAAGG + Intronic
1034602357 7:152272103-152272125 CATAAGTCTATTTTGGAAAAAGG + Intronic
1036014192 8:4763231-4763253 CTGAAAACTCTTTTGGACAAAGG + Intronic
1036968116 8:13323346-13323368 CTTAAAGCTCCTTTAGAAGATGG + Intronic
1037066445 8:14583932-14583954 CTTAAATTATTTTTGTAACAGGG + Intronic
1038007978 8:23450273-23450295 CTTAAATACCTTATGGTACAAGG + Intronic
1038511739 8:28143838-28143860 CTTAAATCCTTTCTGGAACAAGG + Intronic
1039617010 8:38963671-38963693 TTTAAATTTTTTTTGGAGCAGGG - Intronic
1041191191 8:55356450-55356472 CTTAAGTCTTTTTTACAACATGG - Intronic
1042184464 8:66123008-66123030 GTTAAATCTCTCCTGGATCAGGG - Intergenic
1043072704 8:75659036-75659058 ATTAAATCTCCTTTGAAAAATGG + Intergenic
1043575176 8:81648250-81648272 CTTAAGTCTTTTTTGAAACATGG - Intergenic
1044048587 8:87470259-87470281 CTTATTTCTCTTCTGGAATATGG - Intronic
1044209484 8:89533884-89533906 CTTAAATCTGTATTAGAACCAGG - Intergenic
1044273219 8:90271435-90271457 ATTAATACTCTTTTTGAACATGG + Intergenic
1044510551 8:93073343-93073365 CTTGATTCTCTTTTGGATTACGG - Intergenic
1044921082 8:97170362-97170384 CTTATATCTCTAGTAGAACAGGG + Intergenic
1045310179 8:100994314-100994336 CTTAAAGCCTCTTTGGAACAAGG - Intergenic
1045691141 8:104761168-104761190 TCTTCATCTCTTTTGGAACAGGG - Intronic
1046266982 8:111843564-111843586 CATAAAACACTTTTGAAACAAGG - Intergenic
1046533897 8:115483590-115483612 CTTAAATCTCATCTGTAAAATGG - Intronic
1046689929 8:117271324-117271346 ATTCAAGCTCTTCTGGAACAAGG - Intergenic
1046753388 8:117948092-117948114 CTTAAATCTTTTTTGGAAAGAGG - Intronic
1046809483 8:118517012-118517034 CTTAGAACTGTTTTGGAATATGG - Intronic
1047680741 8:127251801-127251823 CTTAAGTCTCTTATATAACATGG + Intergenic
1048751328 8:137679675-137679697 CTTAGATCACTTATGCAACAGGG + Intergenic
1051056749 9:12996353-12996375 CTTAACTCTGATTTTGAACAGGG - Intergenic
1051096166 9:13467878-13467900 CTTAAATGTTTTTAGGAAGAAGG - Intergenic
1052365717 9:27610432-27610454 CTTCATACTCTTTTTGAACATGG + Intergenic
1052764642 9:32628860-32628882 CTTAAATCCTTCCTGGAACAAGG + Intergenic
1052887055 9:33659893-33659915 CTTAAATCTCTTATATAAAATGG - Intergenic
1052890673 9:33696609-33696631 CATAATTCTCTTCTGGATCAGGG + Intergenic
1053109476 9:35445289-35445311 CTTAAATCCTTTATAGAACATGG - Intergenic
1053747277 9:41211473-41211495 CTTAAATCTCTGTTGCAAAAAGG + Intergenic
1054339054 9:63838732-63838754 CTTAAAACTCTATTGCAAAAAGG - Intergenic
1054480009 9:65653887-65653909 CTTAAATCTCTATTGCAAAAAGG - Intergenic
1055413615 9:76058566-76058588 TTTAAATCTTCTTTGGATCAAGG + Intronic
1055674635 9:78644198-78644220 CTGAAATCTATTTTGGAGTAAGG + Intergenic
1056230886 9:84542208-84542230 CTTAAATTTATTTTGGTATAAGG + Intergenic
1056695096 9:88841646-88841668 CTGAAATGTCTTTTGAAATAAGG + Intergenic
1059859335 9:118440936-118440958 CTCAAAATTTTTTTGGAACAAGG - Intergenic
1060397090 9:123323951-123323973 CTCAAGTCTTTTTTGGAACAAGG - Intergenic
1060417403 9:123441674-123441696 CTTAAACCTTCATTGGAACAAGG + Intronic
1202783409 9_KI270718v1_random:22252-22274 CTTAAATCTCTATTGCAAAAAGG + Intergenic
1186878656 X:13842104-13842126 CTTTGATCTCTCATGGAACAAGG + Intronic
1187947177 X:24437642-24437664 CTTAGATCCTTTCTGGAACAAGG - Intergenic
1188786972 X:34358972-34358994 CTTAATAATCTTTTGAAACAGGG - Intergenic
1191869591 X:65734768-65734790 CTTAAATCCTTTTTGGAACAAGG - Intronic
1192195997 X:69028600-69028622 CTGAAAGCTCTTTGAGAACAGGG + Intergenic
1192733641 X:73827015-73827037 CTTCTATCTATCTTGGAACATGG + Intergenic
1193706901 X:84832234-84832256 GTCAGATCTCTTTTGGAGCAGGG - Intergenic
1194810972 X:98387001-98387023 CTTAGATCTCTATAGGACCAGGG - Intergenic
1196116797 X:112007397-112007419 CTTAAATCTCTCTTCTCACAGGG - Intronic
1196432601 X:115642770-115642792 CTTAAGTCTCCTTTAGAAAATGG - Intronic
1196686059 X:118511476-118511498 TTTAAATCTTTTTTAGAAAATGG + Intronic
1197632857 X:128882119-128882141 CTTAAATATTTGTTGGAAGAAGG + Intergenic
1198169893 X:134095244-134095266 CTAAAATCCCTTGAGGAACATGG - Intergenic
1201437305 Y:13972863-13972885 CTTAAATTTTCTTTGGAAGAAGG - Intergenic
1202051888 Y:20790002-20790024 CTTACATCTCTTTGAGAACTTGG + Intergenic