ID: 1022651805

View in Genome Browser
Species Human (GRCh38)
Location 7:32284279-32284301
Sequence GGGCAAACTGCTATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022651798_1022651805 19 Left 1022651798 7:32284237-32284259 CCTATTCACATGGCACTAGCACT 0: 1
1: 0
2: 2
3: 12
4: 95
Right 1022651805 7:32284279-32284301 GGGCAAACTGCTATGGTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 218
1022651796_1022651805 26 Left 1022651796 7:32284230-32284252 CCAAGACCCTATTCACATGGCAC 0: 1
1: 0
2: 1
3: 17
4: 126
Right 1022651805 7:32284279-32284301 GGGCAAACTGCTATGGTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 218
1022651795_1022651805 27 Left 1022651795 7:32284229-32284251 CCCAAGACCCTATTCACATGGCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1022651805 7:32284279-32284301 GGGCAAACTGCTATGGTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 218
1022651797_1022651805 20 Left 1022651797 7:32284236-32284258 CCCTATTCACATGGCACTAGCAC 0: 1
1: 0
2: 2
3: 26
4: 418
Right 1022651805 7:32284279-32284301 GGGCAAACTGCTATGGTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022651805 Original CRISPR GGGCAAACTGCTATGGTGGA AGG Intronic
903238594 1:21967340-21967362 AGGCAAACTCCTATGATGGCAGG + Intergenic
903441280 1:23389773-23389795 GGACAAAATGCTATGGTCAATGG + Intronic
905734424 1:40315982-40316004 GGGCAAACTGGCACAGTGGAAGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907644631 1:56229879-56229901 GTGGAAAGTGCTATGATGGAGGG + Intergenic
908154278 1:61336434-61336456 GGGGAAACTGTTTTGGAGGAGGG - Intronic
908661194 1:66437059-66437081 GTGCTAACTGCTAGGATGGATGG - Intergenic
910044928 1:82902059-82902081 GGCCAAACTGATTTGATGGATGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910924799 1:92387354-92387376 TGGCAAACTGATATGATGGCTGG - Exonic
910984494 1:92992411-92992433 TGGGAATCTGCTTTGGTGGAAGG - Intergenic
915293443 1:154902201-154902223 GGCCAAACTAGGATGGTGGAGGG + Intergenic
915568018 1:156727447-156727469 GGGGAAACTCCTACGGTCGATGG - Exonic
916795237 1:168161214-168161236 GGGCAGACTGGTCTGGTGGTTGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917941884 1:179930463-179930485 GGGCAAACTGCAAAGGTCAAAGG - Intergenic
918125999 1:181584373-181584395 CTCCAAGCTGCTATGGTGGAAGG + Intronic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921434666 1:215104432-215104454 GGGCAAACTGCTGCTGTGTAGGG - Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924362256 1:243254651-243254673 TCGCAAACTGCTACGGCGGAGGG + Intronic
1062829456 10:595962-595984 GTGGACACTGCTATGGTGAATGG + Intronic
1067999101 10:51310890-51310912 GTGCAAACTGCTATGCTAGTAGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1073515972 10:104075880-104075902 GGGGAAAATTCTATGGAGGAGGG - Intronic
1075187016 10:120271573-120271595 TGCCAAACTGCTATAGAGGAGGG + Intergenic
1075520847 10:123142797-123142819 GGGCAAAATGGAATCGTGGAGGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1079130562 11:17744679-17744701 GGGCCAACTTCTATGGTGTAGGG + Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080672009 11:34388876-34388898 GGCCGAACTGCTATAGTTGAAGG + Intergenic
1081142118 11:39514135-39514157 GGGGTAACTGCTCTGTTGGATGG - Intergenic
1081810045 11:45909497-45909519 ATGCAAGCTGCTATGGGGGAGGG - Intergenic
1084253082 11:67917695-67917717 GGGTAAACTGCTTTGGTGATGGG - Intergenic
1084819789 11:71678294-71678316 GGGTAAACTGCTTTGGTGATGGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086167855 11:83800131-83800153 GGGAAAAGTGCTAGGGTTGAAGG + Intronic
1087181451 11:95146264-95146286 GGGCAAATTGCAATGGTTGGTGG - Intergenic
1088866287 11:113851143-113851165 GGCCAGGCTGCTGTGGTGGAGGG - Intronic
1092423327 12:8352555-8352577 GGGTAAACTGCTTTGGTGATGGG - Intergenic
1092680475 12:10974420-10974442 TGGGAATCTGCTATGCTGGAAGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094420783 12:30269015-30269037 AGGCAAACTGCAAAGGTTGAAGG - Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1103411039 12:120711190-120711212 GGGCAGGCTGCAATGGGGGAGGG - Intronic
1104180534 12:126376037-126376059 GAGCACAGTGCTATGGTGCATGG - Intergenic
1106085234 13:26535752-26535774 GGACAAAATGCTATGGTGACAGG + Intergenic
1106606661 13:31235030-31235052 TCTCAAACTGCTGTGGTGGAGGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1116899419 14:50347621-50347643 GGGGAAACTGGTTTGGGGGAAGG + Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118573270 14:67215729-67215751 GGACAAATTGCTAAGTTGGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121347837 14:93149288-93149310 TGGCAAACTGCTTCCGTGGAGGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124083190 15:26520052-26520074 GGGAAAACTGGTAAGGTGGGTGG - Intergenic
1124211634 15:27769540-27769562 GGGCACACTGCTAAGGTGAGGGG + Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131949501 15:97665815-97665837 GGGCAAACTTCCATTGTGAAGGG - Intergenic
1133976222 16:10601454-10601476 GGGGAAACTTCTTTGGGGGAGGG + Intergenic
1138365481 16:56472895-56472917 AGCAAAACTGCTTTGGTGGAAGG - Intronic
1143762695 17:9116449-9116471 GGGGCAGCTGCGATGGTGGAGGG + Intronic
1144725000 17:17497226-17497248 GCCCAAAATGCTATGATGGACGG - Intergenic
1144735916 17:17555435-17555457 GGGGAAACTGTTGAGGTGGAGGG - Intronic
1146372489 17:32274081-32274103 AGGCAGCCTGATATGGTGGAAGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152255567 17:79237476-79237498 GGGTAACCTGCTCTGGGGGACGG - Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159072605 18:63642567-63642589 GTGCAAAATGCTTTGCTGGAAGG - Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925045202 2:767650-767672 AGGCAAACTGCGAGGGTGGGAGG - Intergenic
925644254 2:6019988-6020010 GGGAAAACTGCTTGGGTTGAGGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930242663 2:48952616-48952638 GGGTAAAGTGATGTGGTGGAAGG + Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932669959 2:73728663-73728685 GGGCAAAGAGCCATGGGGGAAGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941010290 2:160292118-160292140 GTGCCAACTGCTATAGTGGTGGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943304511 2:186243096-186243118 GGGCAAGGTGGTGTGGTGGAAGG - Intergenic
943668798 2:190638528-190638550 GGGCAAACTGAGAGGGTGGAAGG + Intergenic
948008604 2:234632418-234632440 GGGAAAACTGCTTTCGTGGGTGG - Intergenic
1171126240 20:22604089-22604111 GGATAAACAGCTATAGTGGAAGG + Intergenic
1171253789 20:23670674-23670696 AGGCAAAGATCTATGGTGGATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173652729 20:44677421-44677443 GGGCAAACTCCTATGGTGGCAGG + Intergenic
1176250768 20:64118905-64118927 GGGCACCCTGATATGGTGGGGGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177372552 21:20222687-20222709 GAGCAAACAGTTATGGTGGTTGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1184981698 22:48100095-48100117 GGGCATATTGCCCTGGTGGAGGG - Intergenic
949303992 3:2618856-2618878 TGGCAACCTGGTATTGTGGAAGG + Intronic
953350036 3:42208563-42208585 GGGCAACCTGGTATCCTGGAGGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956471612 3:69572954-69572976 GATCAAACTGCTGTGGGGGATGG + Intergenic
958445942 3:94215243-94215265 AAGAAAACTGCCATGGTGGAAGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962305567 3:134282961-134282983 GGAGAAACTGCTATGTTGGGTGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
965667888 3:171115506-171115528 GTGCAGACTGGTATGGTTGATGG + Intronic
966823439 3:183943249-183943271 GTAAAAACTGCTGTGGTGGAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969801721 4:9571810-9571832 GGGCAAACTGCTTTGGTGATGGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979569720 4:122205966-122205988 GTACAAACTGCTATGGTAGATGG + Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
991284511 5:64956705-64956727 GTGCAAACAGTTATGGTGGTAGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995435109 5:112127145-112127167 GGGCAAAGGGCTAAGCTGGATGG - Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996315601 5:122157462-122157484 GGGAGAAATGCTGTGGTGGAAGG + Intronic
998507738 5:142685719-142685741 GTGCAGACTGCTCTGGGGGAAGG - Intronic
999363595 5:151006724-151006746 GGGCAAAAGGATAGGGTGGAGGG - Intergenic
999869621 5:155735747-155735769 GGGCAAACTCCTATAGTCAAGGG + Intergenic
1000217092 5:159170250-159170272 GACCAAACTGCTATGGAGCAGGG + Intronic
1002394575 5:178942738-178942760 AGGCAAAGTGCTATGGAGGCAGG - Exonic
1003439309 6:6124325-6124347 GGGCACACTGGTATGTTGGGTGG - Intergenic
1004488488 6:16091116-16091138 GGACACACTGCTTTGGTAGAAGG - Intergenic
1005253266 6:23972059-23972081 GGGGAAACTCCTAGGGTGGATGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005401602 6:25439681-25439703 GGGCAGACTGCTGTGGTTGAGGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006639742 6:35483780-35483802 GGGCAGCCTGATGTGGTGGAGGG - Intronic
1007314774 6:40978643-40978665 GGTCACAGTGCTCTGGTGGATGG + Intergenic
1007818898 6:44545392-44545414 GGGCAAGCTGGTAAGGTGGGTGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008851688 6:56030005-56030027 TGGCAAACTGCTAGGTTGGCTGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1010285194 6:74069117-74069139 GTGACAGCTGCTATGGTGGAAGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014374931 6:120660548-120660570 AGGCAAACTGCAAGAGTGGAGGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016517800 6:144915215-144915237 GGGGAACCTGGTATGGTTGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022651805 7:32284279-32284301 GGGCAAACTGCTATGGTGGAAGG + Intronic
1025306781 7:57868358-57868380 GGGGAAAAAGCTACGGTGGAGGG + Intergenic
1025320136 7:58087036-58087058 GGGCAAAAAGCTGTGGTGGCAGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1033084771 7:138331547-138331569 TGGGTAACTCCTATGGTGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035115936 7:156523972-156523994 GGGCAACCTCCCTTGGTGGAAGG + Intergenic
1036894329 8:12620589-12620611 GGGTAAACTGCTTTGGTGATGGG - Intergenic
1037934336 8:22904508-22904530 GGAAAAAATGCTATGGGGGACGG - Intronic
1038172880 8:25154051-25154073 GCGCATACTGCTCTGGTGAAGGG - Intergenic
1038264408 8:26026672-26026694 GGGGAATCTGTTATTGTGGAAGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1044513973 8:93117063-93117085 GGGTCAAATGCTTTGGTGGATGG - Intergenic
1044802927 8:95975734-95975756 GGGCCAGCTGCTCTGGAGGAAGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045941237 8:107740728-107740750 TGTAAAACTGCCATGGTGGATGG - Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053945957 9:43310918-43310940 GGGCAAAATGCCATGGCGGCGGG - Intergenic
1057143795 9:92745258-92745280 GGGCACACTGGGATGGGGGATGG + Intronic
1060219968 9:121759318-121759340 GGGCAGACATCTAAGGTGGAAGG - Intronic
1061475026 9:130859441-130859463 GGCTAACCTGCTCTGGTGGAGGG + Intronic
1203589092 Un_KI270747v1:39498-39520 GGGCAAAATGCCATGGCGGCGGG - Intergenic
1186261932 X:7789386-7789408 GGGCAAAGTGCAAAGGTGCAAGG + Intergenic
1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195915843 X:109934678-109934700 GAGCAATGTGCTAAGGTGGATGG - Intergenic
1196029097 X:111075866-111075888 GGGCACACTGGTATGAGGGATGG - Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1201985056 Y:19957016-19957038 AGGCAAATTGATATGGGGGAGGG - Intergenic