ID: 1022652173

View in Genome Browser
Species Human (GRCh38)
Location 7:32287445-32287467
Sequence TGGGCATGACCACAGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 252}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022652159_1022652173 28 Left 1022652159 7:32287394-32287416 CCTTCACCAGGGAAGCCCATCCC 0: 1
1: 0
2: 1
3: 23
4: 253
Right 1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 252
1022652160_1022652173 22 Left 1022652160 7:32287400-32287422 CCAGGGAAGCCCATCCCAATCCC 0: 1
1: 0
2: 2
3: 51
4: 408
Right 1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 252
1022652161_1022652173 13 Left 1022652161 7:32287409-32287431 CCCATCCCAATCCCCAGACAAAT 0: 1
1: 0
2: 2
3: 17
4: 270
Right 1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 252
1022652167_1022652173 0 Left 1022652167 7:32287422-32287444 CCAGACAAATTAGATACCCCTGC 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 252
1022652163_1022652173 8 Left 1022652163 7:32287414-32287436 CCCAATCCCCAGACAAATTAGAT 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 252
1022652158_1022652173 29 Left 1022652158 7:32287393-32287415 CCCTTCACCAGGGAAGCCCATCC 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 252
1022652165_1022652173 2 Left 1022652165 7:32287420-32287442 CCCCAGACAAATTAGATACCCCT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 252
1022652166_1022652173 1 Left 1022652166 7:32287421-32287443 CCCAGACAAATTAGATACCCCTG 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 252
1022652162_1022652173 12 Left 1022652162 7:32287410-32287432 CCATCCCAATCCCCAGACAAATT 0: 1
1: 0
2: 1
3: 19
4: 258
Right 1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 252
1022652164_1022652173 7 Left 1022652164 7:32287415-32287437 CCAATCCCCAGACAAATTAGATA 0: 1
1: 0
2: 0
3: 17
4: 221
Right 1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG 0: 1
1: 0
2: 1
3: 31
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022652173 Original CRISPR TGGGCATGACCACAGCACCC TGG Intronic
900207167 1:1436474-1436496 TGGGCATGCACACAGCAGCAGGG - Intronic
900299251 1:1968929-1968951 TGGGCAGGACCGGAGCCCCCAGG - Intronic
900765263 1:4500770-4500792 TGGACATGACCACAGCAGGTGGG - Intergenic
901634496 1:10664293-10664315 TCGCCAGGACCACAGCCCCCAGG - Intronic
902864794 1:19270789-19270811 TGCACCTGACCACAGCGCCCCGG - Intergenic
902867013 1:19286226-19286248 TATGCCAGACCACAGCACCCCGG - Exonic
903386387 1:22929855-22929877 AGGGAATGACCACAGGACACAGG + Intergenic
903693882 1:25193334-25193356 TGGGCATGAGGACAGCTCCGGGG + Intergenic
904920876 1:34007037-34007059 TGTGAATGACCAGAGCATCCTGG + Intronic
905387154 1:37612974-37612996 TGGGCATGGCCACAGGCCCTAGG + Intronic
905468787 1:38176026-38176048 TGGGCTTGCCCCCATCACCCAGG - Intergenic
905672202 1:39799187-39799209 TGGGCATGGGCACCGCAGCCTGG + Intergenic
906668655 1:47639174-47639196 TGGGCAAGCCCACAGCACACAGG - Intergenic
908208316 1:61873787-61873809 TAGGCATGCCCACAGCAGGCTGG + Intronic
912827960 1:112923687-112923709 CAGGCCAGACCACAGCACCCCGG + Intronic
914203131 1:145504258-145504280 GGTGCACGACCACCGCACCCTGG - Intergenic
914237060 1:145822182-145822204 GGTGCACGACCACCGCACCCTGG - Intronic
914482253 1:148077412-148077434 GGTGCACGACCACCGCACCCTGG - Intergenic
915318801 1:155044744-155044766 TGGGCATGACCAGAACAGTCTGG + Intronic
915327650 1:155089070-155089092 TTGGCATTCCCACAGCTCCCAGG - Intergenic
916141448 1:161702807-161702829 TGGGCATGATCCCACCACTCAGG + Intergenic
916901038 1:169224131-169224153 TTGGCATGACCAAGGCATCCAGG - Intronic
918688558 1:187450225-187450247 TGGGACTGACCATACCACCCTGG - Intergenic
919849042 1:201660132-201660154 TGCCCATGACTGCAGCACCCGGG + Intronic
920851863 1:209633506-209633528 TGTGGGTGACCACAGCACTCTGG + Intronic
922264727 1:223973005-223973027 AGGGCAAGACCACAGGACCGGGG - Intergenic
924314056 1:242777085-242777107 TGAGTATGACCACTGCATCCAGG + Intergenic
924383321 1:243482739-243482761 GGGGCCTGGCCACAGCTCCCAGG + Intronic
924440551 1:244082136-244082158 TGGGCAAGTCCTTAGCACCCTGG - Intergenic
1063160003 10:3412252-3412274 TGGGCTGCACCACTGCACCCTGG + Intergenic
1063779067 10:9300226-9300248 TGGGCATTAGCACAGTGCCCTGG - Intergenic
1069550501 10:69360670-69360692 TAGGCATGCCCACAGCCCCTTGG - Intronic
1070251443 10:74776973-74776995 TGGGAATGACCAGAGCAAACAGG - Intergenic
1070711139 10:78684003-78684025 TGGTCATGACCAGAAAACCCAGG - Intergenic
1072618251 10:97063706-97063728 TTGGCTTGAACACAGCACCGGGG - Intronic
1074782443 10:116811740-116811762 TGCCCATGACCTCTGCACCCGGG + Intergenic
1075408738 10:122211812-122211834 GTGGCATCATCACAGCACCCAGG - Intronic
1076343391 10:129765050-129765072 TGAGCATGACCACAGGAGCCAGG - Intronic
1076775660 10:132696776-132696798 TGGGCCGGGTCACAGCACCCAGG + Intronic
1076775675 10:132696826-132696848 CGGGCCACACCACAGCACCCAGG + Intronic
1076824042 10:132958323-132958345 TGGGGATGCCCACAGGACCTGGG + Intergenic
1076877905 10:133225585-133225607 CGGGCATGACCACCTCACCAAGG - Exonic
1077035243 11:491287-491309 GCAGCATGACCCCAGCACCCGGG - Exonic
1077181870 11:1220482-1220504 TAGGCTTGGCCCCAGCACCCAGG + Intergenic
1077908745 11:6556741-6556763 TGTGTATGCCCACAGCACCTTGG + Exonic
1081734611 11:45394247-45394269 TGGGCATGGCCAAAGCCTCCTGG - Intergenic
1082284219 11:50301879-50301901 TGGGCCTGTCCCCAGGACCCTGG - Intergenic
1083125686 11:60563769-60563791 TGGGCATGCCCACAGCGGACTGG - Intergenic
1084118976 11:67057839-67057861 TGGGCATGCCTACAGCGCCAAGG - Intronic
1087133879 11:94694829-94694851 TGACCATGACCACATCAGCCTGG - Intergenic
1087165193 11:94996287-94996309 TGGGTATGAAACCAGCACCCAGG + Intronic
1087492746 11:98848954-98848976 TGGGCATGCCCACAGCAGACTGG + Intergenic
1089466975 11:118691783-118691805 AGGGCCTGACCACAGCACCCGGG - Intergenic
1090863274 11:130673136-130673158 TGGTCATGACCACATCACTCTGG + Exonic
1091466866 12:692316-692338 TTGGCATGTCCATAGCACCAAGG - Intergenic
1091594232 12:1865006-1865028 TGGGCATGACCTCAGCCAGCGGG - Intronic
1094022949 12:25933750-25933772 TGCCCATGGCCAGAGCACCCTGG - Intergenic
1096385510 12:51192417-51192439 TGGCAATGACCACAGCAGGCTGG + Exonic
1098246991 12:68530077-68530099 TGTGAATGACCCCATCACCCCGG - Intergenic
1101403474 12:104408197-104408219 TGGGCATGTCCAGTGCACACGGG + Intergenic
1104571548 12:129930246-129930268 TGGGCAAGAGCGCAACACCCAGG - Intergenic
1104597210 12:130128076-130128098 TGGGCATGGGCACCTCACCCTGG + Intergenic
1104888448 12:132125919-132125941 GGGGCGTGGCCACAGCAACCTGG - Intronic
1105975192 13:25467198-25467220 TGCGTGTGCCCACAGCACCCTGG - Intronic
1108582496 13:51839118-51839140 TGGACTTGACCAGAGCAGCCTGG + Intergenic
1110651851 13:77951156-77951178 TGGGAATGACCAGAGCAAGCAGG + Intergenic
1112606628 13:100912699-100912721 GGGTGATGTCCACAGCACCCCGG - Intergenic
1113566700 13:111323631-111323653 TGTGCAGGACCACAGATCCCGGG - Intronic
1113583675 13:111448268-111448290 TGGGCGTGGTCACAGCATCCAGG + Intergenic
1113682475 13:112254116-112254138 AGGGCATTTCCACAGCACCCCGG + Intergenic
1114522290 14:23347111-23347133 TGGGGATGACCTCAGCAGCAAGG + Exonic
1114711398 14:24781802-24781824 TGAGCATGGCTTCAGCACCCAGG - Intergenic
1119026600 14:71157604-71157626 TGGGGCAGACCACAGCAGCCAGG - Intergenic
1119136101 14:72221852-72221874 TGGGATTGACCCCAGCTCCCAGG - Intronic
1120394835 14:83955836-83955858 TGGGAATGACCAGAGCAAGCAGG - Intergenic
1121679067 14:95777461-95777483 TGGGCAGGAGCACAGGGCCCAGG - Intergenic
1122509411 14:102254526-102254548 TGGGTTTGATCACAGGACCCAGG - Intronic
1122842689 14:104474045-104474067 TGGGCGTTCCCACAGCTCCCCGG + Intergenic
1123131904 14:105994114-105994136 GGGGCATGAATACGGCACCCGGG - Intergenic
1202831874 14_GL000009v2_random:43208-43230 TGGACATGCCCACAGCAGACTGG - Intergenic
1123946503 15:25241344-25241366 TGGGCTTGAGCAAAACACCCAGG - Intergenic
1124700722 15:31909689-31909711 TGGGGATGATAATAGCACCCTGG + Intergenic
1124823019 15:33066699-33066721 TTGGCTTGACCTCACCACCCTGG + Intronic
1127394396 15:58532337-58532359 TTGGCCTGACCACAGAAGCCAGG + Intronic
1127693723 15:61423140-61423162 TGGGGCTTACCACAGCATCCAGG + Intergenic
1128789979 15:70426062-70426084 TGGGCAAGTCCTCAACACCCTGG - Intergenic
1128793270 15:70448506-70448528 TGGACATGACCCCAGCCTCCAGG + Intergenic
1129787001 15:78316240-78316262 AGGGCATGATCACAGCCCCACGG - Intergenic
1129848575 15:78779269-78779291 AGGGTATGCCCCCAGCACCCTGG - Intronic
1130253347 15:82314677-82314699 AGGGTATGCCCCCAGCACCCTGG + Intergenic
1130378213 15:83349384-83349406 TGGACATCACCACAGCCCACTGG - Intergenic
1130886256 15:88095017-88095039 TGGCCATAGCCACAGCTCCCAGG - Intronic
1131272061 15:90953521-90953543 TCAGCACCACCACAGCACCCCGG - Exonic
1131404695 15:92154740-92154762 TGGGAGTGGCCCCAGCACCCTGG + Intronic
1131801310 15:96072215-96072237 TGGCCATGAGCACAGCTCCCCGG - Intergenic
1132534407 16:470823-470845 TGCGCGTGAACCCAGCACCCAGG + Intronic
1134656354 16:15950477-15950499 AGGGCAGGACCACAGCTACCAGG - Intronic
1134668107 16:16034430-16034452 TGTTCATGACTACAGGACCCCGG + Intronic
1136058990 16:27711888-27711910 TAGGCCAGGCCACAGCACCCAGG - Intronic
1136277361 16:29186926-29186948 GGGGCACGCCCCCAGCACCCTGG + Intergenic
1137604526 16:49778658-49778680 TGGGCATGGCCACAGTGCCTGGG - Intronic
1138388066 16:56649745-56649767 AGGGCATGGTCCCAGCACCCAGG - Intronic
1142081738 16:88152970-88152992 GGGGCATGCCCCCAGCACCGTGG + Intergenic
1143399942 17:6637470-6637492 TGGGAGTGCCCACAGCTCCCGGG - Intronic
1143670604 17:8393284-8393306 TGGGCAGGTCCAGAGGACCCTGG - Exonic
1146846365 17:36183895-36183917 TGGGGATGACCAGTGCCCCCCGG + Intronic
1148332566 17:46821060-46821082 TGTTCTTGCCCACAGCACCCAGG - Intronic
1148771235 17:50068075-50068097 TGACCCTGACCACAGCACCTGGG - Exonic
1151768139 17:76142673-76142695 TGGGCAGGACCCCAACTCCCAGG + Exonic
1152206041 17:78974847-78974869 GGGGCGTGACGACTGCACCCAGG + Intronic
1152295708 17:79465960-79465982 TGGGCATCCCCACGGCCCCCAGG + Intronic
1152586955 17:81193466-81193488 TGGGCACGTCCCCAGCCCCCAGG + Intronic
1155904281 18:31430224-31430246 TCTGCATGCCCACAGCACCTGGG - Intergenic
1155923657 18:31630710-31630732 TGTGCTTGACCACAGAAACCAGG + Intronic
1156442321 18:37203746-37203768 TATGTATGACCACAGCACCTAGG - Intronic
1161295315 19:3516730-3516752 TGGGCAAAACCACAGGGCCCAGG - Intronic
1161366319 19:3881731-3881753 TGGGTGTGACCTCAGCCCCCAGG - Intronic
1163257812 19:16168218-16168240 TGGGGATGGCCACATGACCCTGG - Exonic
1163370423 19:16898039-16898061 TGGGCCTGAGCTCAGCGCCCCGG - Intronic
1164274152 19:23702130-23702152 TGGGAATGACCAGAGCAAGCAGG - Intergenic
1165825332 19:38702553-38702575 TGGGCAAGGCCGCAGCTCCCCGG - Intronic
1166334254 19:42095911-42095933 TGGCCAGGCCCACATCACCCTGG + Exonic
1202640813 1_KI270706v1_random:84544-84566 TGGACATGCCCACAGCAGACCGG + Intergenic
926224388 2:10956610-10956632 TGGGCATCTCCTCAGCAGCCGGG + Intergenic
926888968 2:17622927-17622949 TGGCCATGTCCAAACCACCCTGG + Intronic
928235658 2:29537317-29537339 TGAGCAGGGCAACAGCACCCTGG - Intronic
928950014 2:36806128-36806150 TGGGCATCTCCACAGAACCCAGG - Intronic
929762432 2:44817107-44817129 TTGGCAGGACCAGAGCAGCCTGG + Intergenic
930024254 2:47020796-47020818 TGGGCCTGACCACTGGACACAGG - Intronic
934969653 2:98752732-98752754 TGGGAATGACCAGAGCACACAGG - Intergenic
936349859 2:111704325-111704347 TGGGCATGTCCACAGTACTGGGG + Intergenic
936506244 2:113109873-113109895 TGGGGATGAAGACAGCACCTTGG - Intronic
937301814 2:120847437-120847459 TGGGAGAGACCACTGCACCCAGG + Intronic
938244288 2:129765244-129765266 TGTGCTTGACCTCAGCACCTTGG - Intergenic
939430341 2:142096806-142096828 TATGCATGACCCCATCACCCAGG + Intronic
941854125 2:170212807-170212829 TGGGCATCCCCACAGCAGACTGG - Intronic
942585717 2:177474529-177474551 TGGGCATGCCCACAGCAGACTGG - Intronic
942842056 2:180374024-180374046 TTATCATGACCACAGCACCGAGG - Intergenic
943253898 2:185568159-185568181 TGGGCATGCCCACAGCAGACTGG - Intergenic
943674938 2:190707302-190707324 TGGGCATGGGCCCTGCACCCTGG + Intergenic
946400931 2:219468183-219468205 TGGGCATGACCCCAGCACAGAGG + Intronic
946424597 2:219586737-219586759 TGGGAATGACCAGAGCAAGCAGG + Intergenic
946504952 2:220289156-220289178 TGCTCATGACCACTGCACCCAGG - Intergenic
947724058 2:232386637-232386659 TGGGCAAGGCCACTGCGCCCCGG + Intergenic
947741214 2:232485805-232485827 TGGGCAAGGCCACTGCGCCCCGG + Intronic
948464138 2:238144204-238144226 TGGGGATGACCCCAGCCTCCCGG - Intronic
948625740 2:239266863-239266885 TGGGGAAGGCCACAGCACCTGGG - Intronic
1170421721 20:16200018-16200040 TGGGCATGACTGCAGCACATTGG - Intergenic
1170842453 20:19935032-19935054 GTGGCATGCCCACAGCGCCCGGG - Intronic
1171028254 20:21652608-21652630 TGGGAATGACCAGAGCAAGCAGG - Intergenic
1171783541 20:29442915-29442937 TGGGGATGCCCACAGCCTCCTGG - Intergenic
1172358409 20:34295385-34295407 TGGGCCTCACCTCAGCACCCAGG + Exonic
1173540858 20:43849862-43849884 TGGTCATGAGCACTTCACCCTGG - Intergenic
1175845522 20:62056529-62056551 TCGCCATCAGCACAGCACCCTGG + Intronic
1175882579 20:62269458-62269480 TGTGCATTTCCACAGCAGCCGGG + Intronic
1179584861 21:42368002-42368024 GGGGCCTGACCGCAGGACCCAGG + Intergenic
1180028268 21:45181326-45181348 TGGTCATGAGCAGAGCAGCCAGG - Intronic
1180174846 21:46082506-46082528 TGGGACTGACCACAGCCTCCCGG - Intergenic
1180361140 22:11897318-11897340 TGGACATGCCCACAGCAGACCGG - Intergenic
1181030680 22:20147699-20147721 TGGCCAAGACCACAGGACCTTGG - Exonic
1181344402 22:22207705-22207727 TGGTGATGACCACAGGCCCCTGG + Intergenic
1181512633 22:23395686-23395708 TGGCCATGACCACAGGACCTTGG + Intergenic
1181535084 22:23537663-23537685 AGGGCAGGACCCCAGCACCCGGG + Intergenic
1181683281 22:24510896-24510918 AGAGCATGACCACAGCTGCCGGG + Intronic
1183114701 22:35681855-35681877 TGGGCATACCCACAGCAGACTGG - Intergenic
1184402801 22:44283579-44283601 GGGGCAGGAAAACAGCACCCAGG + Intronic
1184640872 22:45869316-45869338 TGGTCCTGACCTCAGCGCCCTGG + Intergenic
1185416422 22:50712774-50712796 TGGGCTGCAACACAGCACCCTGG - Intergenic
950123215 3:10495543-10495565 TGGGCTTCACTACAGCCCCCGGG - Intronic
953250923 3:41245212-41245234 TGGAGATGAGCACACCACCCAGG + Intronic
953607438 3:44420897-44420919 TGGGCTTGAGGACAGCACTCAGG - Intergenic
954035514 3:47849003-47849025 TTGGCAGGACCGCAGCTCCCGGG + Exonic
954078164 3:48196297-48196319 TGTGCAGGGGCACAGCACCCAGG - Intergenic
954445729 3:50545885-50545907 AGGGCAGGAGCACAGCAGCCAGG - Intergenic
955002187 3:54937818-54937840 CGGGCATGATCACAGCACAGAGG + Intronic
957428207 3:80067762-80067784 TGGACATGACAACAACACCATGG + Intergenic
957823252 3:85406916-85406938 CGGGCATGACCACTGTACCCTGG - Intronic
959581171 3:107983961-107983983 TGAGGATGACCACTGAACCCTGG - Intergenic
963001332 3:140684566-140684588 TGCTAATGACCACATCACCCCGG + Intronic
964335349 3:155648908-155648930 TGGGCATTGTCACAGCACTCTGG - Intronic
964858246 3:161170865-161170887 TGGTCATGACCAGATCATCCAGG - Intronic
966598433 3:181749404-181749426 TGAGAATGACAACAGCACACAGG + Intergenic
967212764 3:187183388-187183410 TGGGCATGCCCACAGCCGACTGG + Intergenic
967983681 3:195080266-195080288 TGGGGATGCCCACAGCCCTCTGG + Intronic
1202737743 3_GL000221v1_random:22843-22865 TGGACATGCCCACAGCAGACTGG - Intergenic
968869532 4:3234662-3234684 TGGGGCTGACCTCAGCACCATGG + Intronic
970809063 4:20070272-20070294 TGGGCATGGGCACAGAACACTGG - Intergenic
973050066 4:45585482-45585504 TGGGCATGACTGCAGGCCCCAGG + Intergenic
974480079 4:62431702-62431724 TGGGCATGCCCACAGCAGACTGG - Intergenic
976862407 4:89681375-89681397 TGGGCATGCCCACAGCAGACCGG + Intergenic
977586404 4:98779821-98779843 TGGGCATGCCTACAGTGCCCAGG + Intergenic
979180287 4:117718167-117718189 TGGGCCTGACCTCAGACCCCAGG - Intergenic
982508941 4:156255827-156255849 TTGCCATGACTACAGCTCCCTGG - Intergenic
985047110 4:185951610-185951632 TGGGCATAAACACAGTTCCCTGG + Intronic
1202768179 4_GL000008v2_random:170399-170421 TGGACATGCCCACAGCAGACCGG + Intergenic
985477413 5:85968-85990 TGTGGATGGCCACAGCATCCTGG + Intergenic
985669745 5:1201216-1201238 TGGGCCTCTCCACAGCTCCCTGG - Intergenic
986724146 5:10581600-10581622 TGGGCTAGGCCACAGTACCCAGG + Intronic
986873804 5:12081533-12081555 TGGGCTTGACCTCAGGCCCCTGG - Intergenic
991502406 5:67289991-67290013 AGGCAATGACCATAGCACCCTGG + Intergenic
993398923 5:87424944-87424966 TTGTCATGACAACAGCAACCAGG + Intergenic
994360027 5:98839821-98839843 TGGGCATGCCCACAACAGACTGG - Intergenic
997697456 5:135872903-135872925 TGGGCATGAGCACAGGCACCTGG - Intronic
1000675695 5:164120015-164120037 TGGGCATGCCCACAGCAAACTGG - Intergenic
1001105600 5:168851599-168851621 TGGGGATGACCACAGGATGCAGG - Intronic
1002333978 5:178465543-178465565 TGGACAGGCCCACAGCACCCAGG + Intronic
1002634828 5:180602081-180602103 TGTGCCTGACATCAGCACCCTGG - Exonic
1002861419 6:1082905-1082927 TGGGCATAATGACAGCACCTAGG - Intergenic
1004426340 6:15509708-15509730 TGGGGATGACCCCAGAACACAGG - Intronic
1004884005 6:20034794-20034816 TGGTCAAGAGCACAGCACACTGG - Intergenic
1006609819 6:35287647-35287669 AGGCTATGACCCCAGCACCCTGG + Exonic
1006938474 6:37735286-37735308 AGACCATGAGCACAGCACCCAGG + Intergenic
1009702680 6:67202984-67203006 TGGGAAGGACCATAGAACCCAGG - Intergenic
1012105295 6:95149671-95149693 TGTGCATGTCCACAGCAAGCTGG + Intergenic
1014255275 6:119155204-119155226 TGGGAATGTCCAGAGCACCCAGG - Intergenic
1017487227 6:154914515-154914537 TGGGCAGACCCACCGCACCCTGG - Intronic
1019478969 7:1257349-1257371 AGGGGGTAACCACAGCACCCTGG - Intergenic
1019488636 7:1300893-1300915 TGGGCAGGAGCTCAGCGCCCAGG + Intergenic
1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG + Intronic
1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG + Intronic
1023830496 7:44036476-44036498 AGGCCATTCCCACAGCACCCAGG + Intergenic
1023830508 7:44036516-44036538 AGGGCACTCCCACAGCACCCAGG + Intergenic
1024107783 7:46110265-46110287 TGGGCATACCCACACCATCCTGG + Intergenic
1024363719 7:48497604-48497626 TGGGCCTGATGACACCACCCTGG + Intronic
1025190134 7:56890079-56890101 GGGGCATCAGCACAGCACCCTGG + Intergenic
1025681804 7:63686841-63686863 GGGGCATCAGCACAGCACCCTGG - Intergenic
1026924024 7:74176751-74176773 AGGGCATGTCCCCAGCAGCCAGG + Intronic
1028650945 7:93150248-93150270 TGGGAATGACCAGAGCAAGCAGG - Intergenic
1029162899 7:98565238-98565260 TGGGCAGGACTACAGGACACAGG + Intergenic
1029345554 7:99976064-99976086 TGGGCAGGGCCCCAGGACCCAGG - Exonic
1029346232 7:99980707-99980729 TGGGCATGGCCCCAGGACCCAGG + Intergenic
1029558945 7:101289808-101289830 TGGGCATGGCCCCAGGACCCAGG - Intergenic
1029740818 7:102490770-102490792 AGGCCATTCCCACAGCACCCAGG + Intronic
1029740830 7:102490810-102490832 AGGGCACTCCCACAGCACCCAGG + Intronic
1029758812 7:102589943-102589965 AGGCCATTCCCACAGCACCCAGG + Intronic
1029758824 7:102589983-102590005 AGGGCACTCCCACAGCACCCAGG + Intronic
1031328517 7:120433208-120433230 TGAGCATGACTGCAGCCCCCAGG + Intronic
1031979568 7:128115992-128116014 TGGGCAAGCCCCCAGCTCCCTGG + Intergenic
1032114246 7:129103441-129103463 TGGGCCTGTCCACAGCACTGAGG + Intergenic
1032286458 7:130541431-130541453 TGGGACTGACAGCAGCACCCAGG + Intronic
1034126018 7:148672224-148672246 TGGGCATGCCCACAACAGACTGG - Intergenic
1034535921 7:151725733-151725755 TGGGGAAGACCTCAGCACCCGGG + Intronic
1035320214 7:158024160-158024182 TGGGCATGTTCACAACATCCCGG - Intronic
1036825258 8:11970846-11970868 TGGGCATGAGCCCAGCACAGTGG + Intergenic
1037154628 8:15684747-15684769 AGGACTTGACCACACCACCCAGG - Intronic
1038313552 8:26464199-26464221 ATGGCATGATCACAGCTCCCTGG - Intronic
1040994168 8:53384768-53384790 TGGGCATGCCCACAGCAGACTGG - Intergenic
1045400078 8:101806069-101806091 TGGGCATACTCACATCACCCTGG - Intronic
1047470459 8:125166682-125166704 AGGGTATGACCAGAGGACCCAGG + Intronic
1049796005 8:144497539-144497561 TGGGCCTGTCCACAGCTCCTGGG + Intronic
1050451979 9:5791510-5791532 TTGGGTAGACCACAGCACCCAGG - Intronic
1055278604 9:74648434-74648456 TGCACATGACCAAAGCTCCCTGG - Intronic
1056037108 9:82618357-82618379 TGGGCATTACTTCAGCAACCTGG + Intergenic
1056585384 9:87924471-87924493 AGGGAGTGACCACATCACCCAGG - Intergenic
1056611496 9:88128469-88128491 AGGGAGTGACCACATCACCCAGG + Intergenic
1058990412 9:110250199-110250221 TGGGGATGATAACAGCACTCAGG + Intronic
1059322639 9:113481464-113481486 TGGCCATGACCAGAGGACCCAGG - Intronic
1060034249 9:120241578-120241600 GGGGCTTGACAACAGCACCCAGG - Intergenic
1061119740 9:128635476-128635498 TGGGAATGGCCACAGGGCCCTGG + Intronic
1061245490 9:129399380-129399402 AGGGCGGGACCCCAGCACCCGGG - Intergenic
1061500617 9:130999594-130999616 GTGGCATGACCACAGCTCACTGG + Intergenic
1061727687 9:132590372-132590394 CGCGCATGTCCACAGCACCGGGG - Intergenic
1061746451 9:132743790-132743812 TGGGCACGATCACAGTACCGGGG - Intronic
1061828799 9:133277499-133277521 GGGGCAGGAACACAGCCCCCAGG - Intergenic
1062612598 9:137381801-137381823 TGGGCTTCTCCTCAGCACCCAGG + Intronic
1203706471 Un_KI270742v1:53287-53309 TGGACATGCCCACAGCAGACTGG - Intergenic
1186110214 X:6247479-6247501 TGTGCATCACCACCACACCCAGG + Intergenic
1187851225 X:23593332-23593354 TGGGCATGAGGACAGGTCCCTGG - Intergenic
1188126368 X:26374037-26374059 TGGGCATGCCCACAGCAGAATGG - Intergenic
1190069476 X:47267640-47267662 TGGGTATGACCACAGTAACAAGG - Intergenic
1190070705 X:47276923-47276945 TGGGTATGACCACAGTAACAAGG + Intergenic
1190077354 X:47327428-47327450 TGGGTATGACCACAGTAACAAGG + Intergenic
1193269843 X:79516006-79516028 TGGGCATGCCCACAACAGACTGG + Intergenic
1196418074 X:115494621-115494643 TGGGCATGGCCAAAACAACCTGG + Intergenic
1196975322 X:121152505-121152527 TGGGAATGACCAGAGCAAGCAGG - Intergenic
1198043634 X:132878342-132878364 TGGGCATGCCCACAGCATACTGG - Intronic
1198139279 X:133786568-133786590 TGGGCATGCCCACAGCAGACTGG + Intronic
1198973065 X:142303046-142303068 TGGGCAGGGCAGCAGCACCCTGG + Intergenic
1199717779 X:150518536-150518558 TGGGCAGGCCCAGACCACCCAGG + Intergenic
1199991718 X:152991178-152991200 GGGGCATGACCTCTGCATCCAGG + Exonic
1200301264 X:154979303-154979325 TGGGCCTGACCTCAGACCCCAGG + Intronic
1200755448 Y:6986077-6986099 TGGGCATGACGACAGAAGCAGGG - Intronic
1201390195 Y:13489714-13489736 TGGGCTTGACCCCAGGATCCTGG + Intergenic
1201700011 Y:16870420-16870442 TGGGCATAACCTCAGCACTTTGG + Intergenic
1202063339 Y:20911289-20911311 TGGGAATGACCAGAGCAAGCAGG - Intergenic