ID: 1022652521

View in Genome Browser
Species Human (GRCh38)
Location 7:32290199-32290221
Sequence GCACCCGGCTTGGCTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022652514_1022652521 -6 Left 1022652514 7:32290182-32290204 CCCCAACCCAGCTGGAAGCACCC 0: 1
1: 0
2: 2
3: 25
4: 313
Right 1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG No data
1022652516_1022652521 -8 Left 1022652516 7:32290184-32290206 CCAACCCAGCTGGAAGCACCCGG 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG No data
1022652509_1022652521 18 Left 1022652509 7:32290158-32290180 CCCCAAAGCAGCTGGCACCAATT 0: 1
1: 0
2: 2
3: 12
4: 151
Right 1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG No data
1022652507_1022652521 26 Left 1022652507 7:32290150-32290172 CCAGCTCTCCCCAAAGCAGCTGG 0: 1
1: 1
2: 1
3: 38
4: 392
Right 1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG No data
1022652513_1022652521 1 Left 1022652513 7:32290175-32290197 CCAATTACCCCAACCCAGCTGGA 0: 1
1: 0
2: 3
3: 17
4: 163
Right 1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG No data
1022652515_1022652521 -7 Left 1022652515 7:32290183-32290205 CCCAACCCAGCTGGAAGCACCCG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG No data
1022652511_1022652521 16 Left 1022652511 7:32290160-32290182 CCAAAGCAGCTGGCACCAATTAC 0: 1
1: 0
2: 0
3: 13
4: 227
Right 1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG No data
1022652510_1022652521 17 Left 1022652510 7:32290159-32290181 CCCAAAGCAGCTGGCACCAATTA 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG No data
1022652506_1022652521 30 Left 1022652506 7:32290146-32290168 CCAACCAGCTCTCCCCAAAGCAG 0: 1
1: 0
2: 0
3: 29
4: 306
Right 1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022652521 Original CRISPR GCACCCGGCTTGGCTGAGAC AGG Intronic
No off target data available for this crispr