ID: 1022658798

View in Genome Browser
Species Human (GRCh38)
Location 7:32346735-32346757
Sequence AACACCATGCAGTAACAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022658796_1022658798 6 Left 1022658796 7:32346706-32346728 CCTGCAAATTATGTATAAATCCT No data
Right 1022658798 7:32346735-32346757 AACACCATGCAGTAACAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022658798 Original CRISPR AACACCATGCAGTAACAAAG AGG Intergenic
No off target data available for this crispr