ID: 1022658898

View in Genome Browser
Species Human (GRCh38)
Location 7:32347815-32347837
Sequence GGCTGGACTGCATTCTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022658898_1022658901 16 Left 1022658898 7:32347815-32347837 CCAGATAAGAATGCAGTCCAGCC No data
Right 1022658901 7:32347854-32347876 TTTCATGAGACCCTCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022658898 Original CRISPR GGCTGGACTGCATTCTTATC TGG (reversed) Intergenic
No off target data available for this crispr