ID: 1022666578

View in Genome Browser
Species Human (GRCh38)
Location 7:32416588-32416610
Sequence CAGGAATGGGTGGGTGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022666578_1022666593 28 Left 1022666578 7:32416588-32416610 CCCCTGCCACCCACCCATTCCTG No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666578_1022666587 7 Left 1022666578 7:32416588-32416610 CCCCTGCCACCCACCCATTCCTG No data
Right 1022666587 7:32416618-32416640 TTCAGTCCACAGTCTCTTCAAGG No data
1022666578_1022666592 27 Left 1022666578 7:32416588-32416610 CCCCTGCCACCCACCCATTCCTG No data
Right 1022666592 7:32416638-32416660 AGGTGTAGGGAAGGTGAGCATGG No data
1022666578_1022666590 14 Left 1022666578 7:32416588-32416610 CCCCTGCCACCCACCCATTCCTG No data
Right 1022666590 7:32416625-32416647 CACAGTCTCTTCAAGGTGTAGGG No data
1022666578_1022666589 13 Left 1022666578 7:32416588-32416610 CCCCTGCCACCCACCCATTCCTG No data
Right 1022666589 7:32416624-32416646 CCACAGTCTCTTCAAGGTGTAGG No data
1022666578_1022666591 18 Left 1022666578 7:32416588-32416610 CCCCTGCCACCCACCCATTCCTG No data
Right 1022666591 7:32416629-32416651 GTCTCTTCAAGGTGTAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022666578 Original CRISPR CAGGAATGGGTGGGTGGCAG GGG (reversed) Intergenic