ID: 1022666580

View in Genome Browser
Species Human (GRCh38)
Location 7:32416590-32416612
Sequence ATCAGGAATGGGTGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022666580_1022666590 12 Left 1022666580 7:32416590-32416612 CCTGCCACCCACCCATTCCTGAT No data
Right 1022666590 7:32416625-32416647 CACAGTCTCTTCAAGGTGTAGGG No data
1022666580_1022666589 11 Left 1022666580 7:32416590-32416612 CCTGCCACCCACCCATTCCTGAT No data
Right 1022666589 7:32416624-32416646 CCACAGTCTCTTCAAGGTGTAGG No data
1022666580_1022666593 26 Left 1022666580 7:32416590-32416612 CCTGCCACCCACCCATTCCTGAT No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666580_1022666592 25 Left 1022666580 7:32416590-32416612 CCTGCCACCCACCCATTCCTGAT No data
Right 1022666592 7:32416638-32416660 AGGTGTAGGGAAGGTGAGCATGG No data
1022666580_1022666587 5 Left 1022666580 7:32416590-32416612 CCTGCCACCCACCCATTCCTGAT No data
Right 1022666587 7:32416618-32416640 TTCAGTCCACAGTCTCTTCAAGG No data
1022666580_1022666591 16 Left 1022666580 7:32416590-32416612 CCTGCCACCCACCCATTCCTGAT No data
Right 1022666591 7:32416629-32416651 GTCTCTTCAAGGTGTAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022666580 Original CRISPR ATCAGGAATGGGTGGGTGGC AGG (reversed) Intergenic