ID: 1022666582

View in Genome Browser
Species Human (GRCh38)
Location 7:32416597-32416619
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022666582_1022666591 9 Left 1022666582 7:32416597-32416619 CCCACCCATTCCTGATTCTCATT No data
Right 1022666591 7:32416629-32416651 GTCTCTTCAAGGTGTAGGGAAGG No data
1022666582_1022666587 -2 Left 1022666582 7:32416597-32416619 CCCACCCATTCCTGATTCTCATT No data
Right 1022666587 7:32416618-32416640 TTCAGTCCACAGTCTCTTCAAGG No data
1022666582_1022666589 4 Left 1022666582 7:32416597-32416619 CCCACCCATTCCTGATTCTCATT No data
Right 1022666589 7:32416624-32416646 CCACAGTCTCTTCAAGGTGTAGG No data
1022666582_1022666592 18 Left 1022666582 7:32416597-32416619 CCCACCCATTCCTGATTCTCATT No data
Right 1022666592 7:32416638-32416660 AGGTGTAGGGAAGGTGAGCATGG No data
1022666582_1022666590 5 Left 1022666582 7:32416597-32416619 CCCACCCATTCCTGATTCTCATT No data
Right 1022666590 7:32416625-32416647 CACAGTCTCTTCAAGGTGTAGGG No data
1022666582_1022666593 19 Left 1022666582 7:32416597-32416619 CCCACCCATTCCTGATTCTCATT No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022666582 Original CRISPR AATGAGAATCAGGAATGGGT GGG (reversed) Intergenic
No off target data available for this crispr