ID: 1022666588

View in Genome Browser
Species Human (GRCh38)
Location 7:32416624-32416646
Sequence CCTACACCTTGAAGAGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022666588_1022666593 -8 Left 1022666588 7:32416624-32416646 CCACAGTCTCTTCAAGGTGTAGG No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666588_1022666596 28 Left 1022666588 7:32416624-32416646 CCACAGTCTCTTCAAGGTGTAGG No data
Right 1022666596 7:32416675-32416697 TGAAGCTCAGGGATGCTGTCAGG No data
1022666588_1022666594 16 Left 1022666588 7:32416624-32416646 CCACAGTCTCTTCAAGGTGTAGG No data
Right 1022666594 7:32416663-32416685 TGACAGACAAGATGAAGCTCAGG No data
1022666588_1022666595 17 Left 1022666588 7:32416624-32416646 CCACAGTCTCTTCAAGGTGTAGG No data
Right 1022666595 7:32416664-32416686 GACAGACAAGATGAAGCTCAGGG No data
1022666588_1022666592 -9 Left 1022666588 7:32416624-32416646 CCACAGTCTCTTCAAGGTGTAGG No data
Right 1022666592 7:32416638-32416660 AGGTGTAGGGAAGGTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022666588 Original CRISPR CCTACACCTTGAAGAGACTG TGG (reversed) Intergenic
No off target data available for this crispr