ID: 1022666593

View in Genome Browser
Species Human (GRCh38)
Location 7:32416639-32416661
Sequence GGTGTAGGGAAGGTGAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022666578_1022666593 28 Left 1022666578 7:32416588-32416610 CCCCTGCCACCCACCCATTCCTG No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666584_1022666593 15 Left 1022666584 7:32416601-32416623 CCCATTCCTGATTCTCATTCAGT No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666579_1022666593 27 Left 1022666579 7:32416589-32416611 CCCTGCCACCCACCCATTCCTGA No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666583_1022666593 18 Left 1022666583 7:32416598-32416620 CCACCCATTCCTGATTCTCATTC No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666581_1022666593 22 Left 1022666581 7:32416594-32416616 CCACCCACCCATTCCTGATTCTC No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666585_1022666593 14 Left 1022666585 7:32416602-32416624 CCATTCCTGATTCTCATTCAGTC No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666582_1022666593 19 Left 1022666582 7:32416597-32416619 CCCACCCATTCCTGATTCTCATT No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666586_1022666593 9 Left 1022666586 7:32416607-32416629 CCTGATTCTCATTCAGTCCACAG No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666580_1022666593 26 Left 1022666580 7:32416590-32416612 CCTGCCACCCACCCATTCCTGAT No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data
1022666588_1022666593 -8 Left 1022666588 7:32416624-32416646 CCACAGTCTCTTCAAGGTGTAGG No data
Right 1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022666593 Original CRISPR GGTGTAGGGAAGGTGAGCAT GGG Intergenic
No off target data available for this crispr