ID: 1022671234

View in Genome Browser
Species Human (GRCh38)
Location 7:32458183-32458205
Sequence CTCTAGCAGCACTAGCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022671234_1022671242 12 Left 1022671234 7:32458183-32458205 CCCTCGTGCTAGTGCTGCTAGAG No data
Right 1022671242 7:32458218-32458240 ATGTTACACAGGAAGCATCACGG No data
1022671234_1022671243 25 Left 1022671234 7:32458183-32458205 CCCTCGTGCTAGTGCTGCTAGAG No data
Right 1022671243 7:32458231-32458253 AGCATCACGGTGTTGTGCAATGG No data
1022671234_1022671244 26 Left 1022671234 7:32458183-32458205 CCCTCGTGCTAGTGCTGCTAGAG No data
Right 1022671244 7:32458232-32458254 GCATCACGGTGTTGTGCAATGGG No data
1022671234_1022671240 1 Left 1022671234 7:32458183-32458205 CCCTCGTGCTAGTGCTGCTAGAG No data
Right 1022671240 7:32458207-32458229 GGGGGTAGACCATGTTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022671234 Original CRISPR CTCTAGCAGCACTAGCACGA GGG (reversed) Intergenic
No off target data available for this crispr