ID: 1022673184

View in Genome Browser
Species Human (GRCh38)
Location 7:32475144-32475166
Sequence AAATTGGAACAGCTTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022673184_1022673188 27 Left 1022673184 7:32475144-32475166 CCTGAGGCAAGCTGTTCCAATTT No data
Right 1022673188 7:32475194-32475216 CTCCAACAAGCTCCAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022673184 Original CRISPR AAATTGGAACAGCTTGCCTC AGG (reversed) Intergenic
No off target data available for this crispr