ID: 1022673439

View in Genome Browser
Species Human (GRCh38)
Location 7:32477020-32477042
Sequence TTCCATCTGACACCTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022673439_1022673442 14 Left 1022673439 7:32477020-32477042 CCCAACACAGGTGTCAGATGGAA No data
Right 1022673442 7:32477057-32477079 TGTCTATGCATGCTCATTTGTGG No data
1022673439_1022673443 29 Left 1022673439 7:32477020-32477042 CCCAACACAGGTGTCAGATGGAA No data
Right 1022673443 7:32477072-32477094 ATTTGTGGTTTCTATCACAATGG No data
1022673439_1022673441 -9 Left 1022673439 7:32477020-32477042 CCCAACACAGGTGTCAGATGGAA No data
Right 1022673441 7:32477034-32477056 CAGATGGAATAGAAGAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022673439 Original CRISPR TTCCATCTGACACCTGTGTT GGG (reversed) Intergenic
No off target data available for this crispr