ID: 1022673711

View in Genome Browser
Species Human (GRCh38)
Location 7:32478939-32478961
Sequence ATGGAAGAGGACATCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022673711_1022673715 5 Left 1022673711 7:32478939-32478961 CCTGGGCTGATGTCCTCTTCCAT No data
Right 1022673715 7:32478967-32478989 TGCAGACAACCAAGGCAGAGAGG No data
1022673711_1022673714 -3 Left 1022673711 7:32478939-32478961 CCTGGGCTGATGTCCTCTTCCAT No data
Right 1022673714 7:32478959-32478981 CATTGAAGTGCAGACAACCAAGG No data
1022673711_1022673717 19 Left 1022673711 7:32478939-32478961 CCTGGGCTGATGTCCTCTTCCAT No data
Right 1022673717 7:32478981-32479003 GCAGAGAGGCAGTGCTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022673711 Original CRISPR ATGGAAGAGGACATCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr