ID: 1022673713

View in Genome Browser
Species Human (GRCh38)
Location 7:32478958-32478980
Sequence CTTGGTTGTCTGCACTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022673713_1022673717 0 Left 1022673713 7:32478958-32478980 CCATTGAAGTGCAGACAACCAAG No data
Right 1022673717 7:32478981-32479003 GCAGAGAGGCAGTGCTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022673713 Original CRISPR CTTGGTTGTCTGCACTTCAA TGG (reversed) Intergenic
No off target data available for this crispr