ID: 1022673717

View in Genome Browser
Species Human (GRCh38)
Location 7:32478981-32479003
Sequence GCAGAGAGGCAGTGCTAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022673709_1022673717 27 Left 1022673709 7:32478931-32478953 CCTCAGGCCCTGGGCTGATGTCC No data
Right 1022673717 7:32478981-32479003 GCAGAGAGGCAGTGCTAGAAAGG No data
1022673710_1022673717 20 Left 1022673710 7:32478938-32478960 CCCTGGGCTGATGTCCTCTTCCA No data
Right 1022673717 7:32478981-32479003 GCAGAGAGGCAGTGCTAGAAAGG No data
1022673711_1022673717 19 Left 1022673711 7:32478939-32478961 CCTGGGCTGATGTCCTCTTCCAT No data
Right 1022673717 7:32478981-32479003 GCAGAGAGGCAGTGCTAGAAAGG No data
1022673713_1022673717 0 Left 1022673713 7:32478958-32478980 CCATTGAAGTGCAGACAACCAAG No data
Right 1022673717 7:32478981-32479003 GCAGAGAGGCAGTGCTAGAAAGG No data
1022673712_1022673717 6 Left 1022673712 7:32478952-32478974 CCTCTTCCATTGAAGTGCAGACA No data
Right 1022673717 7:32478981-32479003 GCAGAGAGGCAGTGCTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022673717 Original CRISPR GCAGAGAGGCAGTGCTAGAA AGG Intergenic
No off target data available for this crispr