ID: 1022674064

View in Genome Browser
Species Human (GRCh38)
Location 7:32481929-32481951
Sequence TCCGTATGTTGAGGGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022674064_1022674067 8 Left 1022674064 7:32481929-32481951 CCAGCATTCCCTCAACATACGGA No data
Right 1022674067 7:32481960-32481982 ACAAATTTTCCTTCGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022674064 Original CRISPR TCCGTATGTTGAGGGAATGC TGG (reversed) Intergenic
No off target data available for this crispr