ID: 1022674073

View in Genome Browser
Species Human (GRCh38)
Location 7:32482065-32482087
Sequence CATAACACAGGCCTGCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022674073_1022674081 6 Left 1022674073 7:32482065-32482087 CCTCTGAGCAGGCCTGTGTTATG No data
Right 1022674081 7:32482094-32482116 TGGGTGCCAGTGAAGGTTATAGG No data
1022674073_1022674078 -1 Left 1022674073 7:32482065-32482087 CCTCTGAGCAGGCCTGTGTTATG No data
Right 1022674078 7:32482087-32482109 GGCCACCTGGGTGCCAGTGAAGG No data
1022674073_1022674083 23 Left 1022674073 7:32482065-32482087 CCTCTGAGCAGGCCTGTGTTATG No data
Right 1022674083 7:32482111-32482133 TATAGGATAAGCCCGTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022674073 Original CRISPR CATAACACAGGCCTGCTCAG AGG (reversed) Intergenic
No off target data available for this crispr