ID: 1022674078

View in Genome Browser
Species Human (GRCh38)
Location 7:32482087-32482109
Sequence GGCCACCTGGGTGCCAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022674073_1022674078 -1 Left 1022674073 7:32482065-32482087 CCTCTGAGCAGGCCTGTGTTATG No data
Right 1022674078 7:32482087-32482109 GGCCACCTGGGTGCCAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022674078 Original CRISPR GGCCACCTGGGTGCCAGTGA AGG Intergenic
No off target data available for this crispr