ID: 1022675413

View in Genome Browser
Species Human (GRCh38)
Location 7:32495265-32495287
Sequence GCTTACGTGACCCGGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022675413_1022675424 11 Left 1022675413 7:32495265-32495287 CCAGCCGCCCGGGTCACGTAAGC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1022675424 7:32495299-32495321 GCTCCTCGTCAAGTCCCACCCGG 0: 1
1: 0
2: 0
3: 15
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022675413 Original CRISPR GCTTACGTGACCCGGGCGGC TGG (reversed) Intronic