ID: 1022675413

View in Genome Browser
Species Human (GRCh38)
Location 7:32495265-32495287
Sequence GCTTACGTGACCCGGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022675413_1022675424 11 Left 1022675413 7:32495265-32495287 CCAGCCGCCCGGGTCACGTAAGC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1022675424 7:32495299-32495321 GCTCCTCGTCAAGTCCCACCCGG 0: 1
1: 0
2: 0
3: 15
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022675413 Original CRISPR GCTTACGTGACCCGGGCGGC TGG (reversed) Intronic
900091786 1:923983-924005 ACTGACGCGGCCCGGGCGGCGGG + Intergenic
900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG + Intronic
900593336 1:3469334-3469356 GAGGACGTGACCCGGGTGGCAGG - Intronic
901428586 1:9198907-9198929 GCTGACTTGGCCCGGGCGGCGGG + Intergenic
903811162 1:26035747-26035769 GCTTGCGAGCCCCGGGGGGCGGG + Exonic
910448933 1:87328242-87328264 GGTGAAGTGACCCGGGCGCCTGG - Intergenic
911770870 1:101740844-101740866 GGTTACCTGAACCGGGAGGCTGG + Intergenic
915225003 1:154405562-154405584 GCTAATGGGAACCGGGCGGCAGG - Exonic
922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG + Intergenic
1064860195 10:19817406-19817428 GCTTACTTCACCTGGGCGGCAGG + Intronic
1088594724 11:111432260-111432282 GTTTAAGTGATCCGGGAGGCAGG - Intronic
1089800585 11:121024049-121024071 GCGGACGTGACACGTGCGGCGGG + Intergenic
1102501833 12:113358560-113358582 AGTCACGTGACCCGGGCTGCGGG + Exonic
1105389466 13:19960281-19960303 GCTCACGTTACCCGGGAGGAGGG + Intronic
1123833676 15:24167091-24167113 GCTACTGTGACCTGGGCGGCGGG - Intergenic
1123840416 15:24242127-24242149 GCTACTGTGACCTGGGCGGCGGG - Intergenic
1123853363 15:24382654-24382676 GCTACTGTGACCTGGGCGGCGGG - Intergenic
1124975043 15:34523118-34523140 ACTTGCGTGACCCGATCGGCTGG - Intergenic
1126299995 15:47184594-47184616 GCGCACGGGAACCGGGCGGCGGG - Intronic
1128374125 15:67063844-67063866 CCTTCCGTGACCCAGGCAGCTGG + Intronic
1136067675 16:27769777-27769799 GCTGACGTGACCGGAGCTGCTGG - Intronic
1142881558 17:2885899-2885921 ACTTAGGTGACCAGGGCAGCTGG + Intronic
1152587279 17:81194682-81194704 TCTGCCGTGACCCGGGGGGCAGG - Intronic
1160499146 18:79393965-79393987 GATTCCGTCACCCGGGCGGGGGG + Intergenic
1166871634 19:45874368-45874390 GCTTACTTGCCCTGGGTGGCTGG + Intergenic
937086021 2:119172360-119172382 GCTTACGTGACCGTGGGGGCTGG + Intergenic
1170597072 20:17814108-17814130 GCTTATGTGACCGTGGAGGCTGG + Intergenic
1185272376 22:49935308-49935330 GCTTGGGGGACCCGGGCGGGCGG + Intergenic
953863776 3:46566171-46566193 GCTTACCTGCCCCGAGGGGCGGG + Exonic
965134354 3:164742122-164742144 GCTTGTGTGACCCAGGTGGCAGG - Intergenic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
990347362 5:54883855-54883877 GCATTCCTGAGCCGGGCGGCCGG - Intergenic
997638171 5:135430243-135430265 GCTTGCGTGAGCGGGGCAGCGGG - Intergenic
1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG + Intergenic
1011917569 6:92526953-92526975 GCTTAAGTGACCTAGGCTGCAGG - Intergenic
1018027524 6:159817652-159817674 GCCTACGTGCCCAGGGCTGCAGG - Intronic
1020129688 7:5552799-5552821 GCTTACGTGCCCGGGGAGGGAGG + Intronic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1055757607 9:79572628-79572650 TCTCGCGTGACACGGGCGGCAGG - Exonic
1062567382 9:137169265-137169287 GCTCACCTGACGCGGGCAGCGGG + Exonic